Transcript asmbl_66691

Sequence
Transcript Sequence for observation asmbl_66691 of TGE0020280:
AGCAGCAGCAGCCGCCGCACCACCACCACCATTATTATTACTACAACCACAGCCACAACCACCATCACCACCACCATCACCAGCAGCCTCACCAATACCTGCAGCATGGAGCCGAGGGCAGCCCCAAGGCCCAGCCAAAGCCGCTGAAACATGAGCAGAAACACGCCCTCCAGCAGCACCAGGAAACGCCGAAGAAGAAAACAGGCTATGGTGAACTAAATGGTAATGCTGGAGAAAGAGAAGTATCTTTAAAGAACCTGGGTTCTGATGAAGCTACCAGCCCAATTTCCAGGGTCCTCAATGGCAACCAACAAGTTGTAGACACTAATCCGAAGCAGACTGTAAAGACCAGCACCTTTGGGAAAGCAGGAATTAAAACCAGGAATTTCATTCAGAAGAACAGTATGGACAAAAAGAATGGAAAGTCTTATGAAAATAAATCTGGAGAGAACCAGTCTGTAGATAAGAGTGATGCTGTAGCAATTCCAAATGGTGTTGTAACAAATAATTCTGGCTATATTACTAATGGTTATATGGGCAAAGGAGCAGATAATGATGGTAGTGGATCTGAGAGCGGATATACCACTCCTAAAAAAAGGAAAGCTAGGCGCAATAGTGCCAAGGGTTGTGAAAACCTTAATTTAGTGCAGGACAAAATAATGCAACAAGAGACCAGTGTCCCAACCTTAAAACAGGGACTTGAAACTTTCAAGCCTGACTATAGTGAACAAAAGGGAAATCGAGTAGATGGTTCAAAGCCCATTTGGAAGTATGAAACTGGGCCTGGAGGAACAAGTCGAGGAAAACCTTCTGTGGGTGATATGCTGCGGAAAAGTTCTGATATTAAACCTGGCGTGAGCAGCAAAAAATTTGATGACCGGCCCAAAGGAAAGCATGCTTCTGCTGTTGCCTCCAAAGAGGACTCATGGACCCTATTTAAACCACCTCCAGTTTTTCCAGTAGACAATAGCAGTGCTAAAATAGTTCCTAAAATAAGTTATGCAAGCAAAGTTAAGGAAAACCTCAACAAAACTGTACAGAACTCTTCTGTGTCACCATCTTCATCTTCATCCTCTTCAT