Transcript asmbl_66295

Sequence
Transcript Sequence for observation asmbl_66295 of TGE0007304:
AGGTTGACTTTTCACCACACTGAAACCATTAGGAAAAATCCTTGTGGTTAACAGCAGAGGCTTCAGAGTGTAACCTGTACTGGGGCCTAGAAATTATTTTAAATGGCGACTGATACGTCTCAAGGTGAACTCGTCCATCCTAAGGCACTCCCACTTATAGTAGGAGCTCAGCTGATCCACGCGGACAAGTTAGGTGAGAAGGTGGAAGAGAGCGCCATGCCGATTCGTCGAGCTGTGAATTCTACCCGGGAAACTCCTCCCAAAAACAAGCTTGCTGAAGGGGAGGAAGGAAAGCCAGAACCAGACGTAAGTTCAGAGGAATCTATCTCTACCGTAGAAGAACAAGAGAATGAAACTCCACCTGCTACATCTAGTGAGGCAGAGCAGCCAAAGGGGGAACCTGAGAATGAAGAGAAGGAAGAAAACAAGTCTTCTGAGGAAACCAAAAAGGATGAGAAAGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAAACAATACCTTCCTGGGCTACCCTTTCTGCCAGCCAGCTAGCCAGGGCCCAGAAACAAACACCGATGGCTTCCTCCCCACGTCCCAAGATGGATGCAATCCTAACGGAGGCCATTAAGGCGTGCTTCCAGAAGAGTGGTGCATCAGTTGTTGCTATTCGAAAATACATCATCCATAAGTACCCTTCTCTGGAGCTGGAGAGAAGAGGCTACCTCCTTAAACAAGCACTGAAAAGAGAATTAAATAGAGGTGTCATCAAACAGGTAAAAGGAAAAGGTGCTTCTGGGAGTTTTGTGGTGGTCCAGAAATCAAGAAAAACCCCACAGAAATCTAGAAACAGAAAGGACAGGAGCTCTGCAGTGGATCCAGAACCACAAGTAAAATTGGAAGATATCCTCCCATTGGCCTTTACTCGCCTTTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGAAAATACGTGTCTCAGTATTACCCTAAACTTAGAGTGGACATCAGGCCTCAGCTGTTGAAGAATGCTCTGCAAAGAGCAGTAGAGAGAGGCCAGTTAGAACAAATAACTGGCAAAGGAGCTTCTGGAACATTCCAGCTGAAGAAATCAGGGGAGAAACCCCTGCTTGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAATGAGCCGAAGACCTGCTCCACCACTGCTCTGAAGAAGTATGTCCTGGAGAACCACCCAGGGACCAATTCTAACTATCAAATGCATCTGCTAAAAAAAACCTTGCAGAAATGCGAAAAGAATGGGTGGATGGAACAGATCTCTGGTAAAGGATTCAGTGGCACCTTCCAGCTCTGTTTTCCCTATTACCCCAGCCCAGGAGTTCTATTTCCAAAGAAAGAGCCAGATGATTCTAAAGATGAGGATGAAGATGAAGATGACTCATCAGAAGAAGACTCTGAGGATGAAGAGCCTCCACCTAAGAGGTTACAAAAGAAAACCCCAGCCAAGTCATCAGGGAAGGCTGCATCCATGAAGCAGAGAGGGTCCAAGCCTCTACCGAAAGTCCCAGCTGCCCAGCGGGGGAAAGCTAGGCCCCTGCCCAAGAAAGCCTCTCCTAAGGCCAAAACTCCTGCCAAGAAAGCTAGACCCTCACCCTCAGTCATCAAGAAACCTAGTGGTGGCTCTTCAAAGAAGCCTGCGGCCAGTGTGAGAAAGGAAGTGAAATTGCCTGGCAAGGGCAAATCTACCATGAAGAAATCTTTCAAAGCAAAAAAGTAAATTTTATAGGGAAAAAAGGGTATCATGATGAAATTTAAAATCTTATTTTATAAGGTCAGTGTGCATTTGTTTTAGTTTTGATGCTTTTAAAATTATATTTTTTCCTTCCCCTCAGAACATTGTGAGGAGGGAATATAAATAAACCAGTTTAGGCATTCGTTAGCTTTTGGCACTATTCTTGGTGTCTGCCCCTTCCCTCGGTCATTTCATTTTCTGCGATAATTCTGGACTTGCCTGAACTGTATAATCTATACATGTCTATTTTTCTCCCTCCACCCCAACCCTCTTTTTGTTTGTTTGTTTGTTTGTT