Transcript asmbl_66036

Sequence
Transcript Sequence for observation asmbl_66036 of TGE0002492:
GCGTGCCCCTGTCCGGCAGCTGAGGAGACCCCGCGCAGTGCTGCCAACGCCCCGGCGGAGAAGCTGAGGTCATCATCGGATTTGAAATATTTAAAGTGGATAGAAAACTGTTTCAGCAATGCAGACAATTAAGTGCGTTGTCGTAGGCGATGGTGCCGTTGGTAAAACATGTCTCCTGATATCCTATACAACAAACAAATTTCCATCTGAGTATGTACCAACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAGCCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGCTACCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCCTCATTTGAAAATGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACCCAAATTGATCTCAGAGATGACCCTTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACGGCTGAAAAGTTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTCACACAGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCAGAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATGAACGTCTCTCCAGAGCCCTTTCTGCACAGCTCATGTCGGCATCATACTAAAAGCAATGTTTAAATCAAACTAAAGATTAAAAATTAAAATTCGTTTTTGCAATAATGACAAATGCCCTGCACCTACCCACATGCACTCATGTGAGACAAGGCCCATAGGTATGGCCCCTTTCCCCGTCTCAATACTAGTTAATTTTGAGTAATTGTGTATTGTCAGAAAAGTGATAAGTACTAGTTCTTGTTTTGTTGTTTCAAAAAAATTTTTTTGTTGTTTTTTTTGTTTAAAAGCAAGGCATGCTTGTGATGACTCTGTAACAGACTAATTTGGGTTGTTGAGCTGCTCCCGGGTTCCACTCCGGAGAGTGATCTGAGACATTT