Transcript asmbl_14189

Sequence
Transcript Sequence for observation asmbl_14189 of TGE0000266:
TGCGTTCTCCGAACGGTCTTCTTCCGACAGCTTGCTGCCCTAGACCAGAGTTGGTGGCTGGACCTCCTGCGACTTCCGAGTTGCGATGCTGTACTTCTCTTTGTTTTGGGCGGCTCGGCCTCTGCAGAGATGTGGGCAGCTGGTCAGGATGGCCATTCGGGCTCAGCACAGCAACGCAGCCCAGACTCAGACTGGGGAAGCAAACAGGGGCTGGACAGGCCAGGAGAGCCTGTCGGACAGTGATCCTGAGATGTGGGAGTTGCTGCAGAGGGAGAAGGACAGGCAGTGTCGTGGCCTGGAGCTCATTGCCTCAGAGAACTTCTGCAGCCGAGCTGCGCTGGAGGCCCTGGGGTCCTGTCTGAACAACAAGTACTCGGAGGGTTATCCTGGCAAGAGATACTATGGGGGAGCAGAGGTGGTGGATGAAATTGAGCTGCTGTGCCAGCGCCGGGCCTTGGAAGCCTTTGACCTGGATCCTGCACAGTGGGGAGTCAATGTCCAGCCCTACTCCGGGTCCCCAGCCAACCTGGCCGTCTACACAGCCCTTCTGCAACCTCACGACCGGATCATGGGGCTGGACCTGCCCGATGGGGGCCATCTCACCCACGGCTACATGTCTGACGTCAAGCGGATATCAGCCACGTCCATCTTCTTCGAGTCTATGCCCTATAAGCTCAACCCCAAAACTGGCCTCATTGACTACAACCAGCTGGCACTGACTGCTCGACTTTTCCGGCCACGGCTCATCATAGCTGGCACCAGCGCCTATGCTCGCCTCATTGACTACGCCCGCATGAGAGAGGTGTGTGATGAAGTCAAAGCACACCTGCTGGCAGACATGGCCCACATCAGTGGCCTGGTGGCTGCCAAGGTGATTCCCTCGCCTTTCAAGCACGCGGACATCGTCACCACCACTACTCACAAGACTCTTCGAGGGGCCAGGTCAGGGCTCATCTTCTACCGGAAAGGGGTGAAGGCTGTGGACCCCAAGACTGGCCGGGAGATCCCTTACACATTTGAGGACCGAATCAACTTTGCCGTGTTCCCATCCCTGCAGGGGGGCCCCCACAATCATGCCATTGCTGCAGTAGCTGTGGCCCTAAAGCAGGCCTGCACCCCCATGTTCCGGGAGTACTCCCTGCAGGTTCTGAAGAATGCTCGGGCCATGGCAGATGCCCTGCTAGAGCGAGGCTACTCACTGGTATCAGG