Transcript asmbl_64983

Sequence
Transcript Sequence for observation asmbl_64983 of TGE0007215:
GAAGGGTCGGGCCCGCGATTAGGTCATGGCGCTGGCCGCTCGACTCTGGCGCTTTCTCCCTTCGGGACGCGGCACTGCCGTGGGAACTCGGTTTCTGACGGGTGCTGCTGGCAGCCGCGGGACTTGCGGGCCTGGGCGACTCGGCGGCTCTGAGGTGATGGGAAACCCAGGAGCCTTTAAAAGAAGCCTCATATTCTCAGCCTTGTCTTATTTGGGTTTTGAGACTTATCAAGTCATCTCTCGGACTGCTGTGGTTCATGCCACAGCCAAAGTCTTGGGAGTTGAAGAAGTCCTTGCACAAGCAGACTACCTCTACGAAAGTGGAGAAACAGAAAAACTTTATCAGCTGCTGACCCAGTACAAGGACAGCGAAGATGCAGAGTTACTGTGGCGTTTGGCACGGGTGTCACGGGACGTAGCTCAGCTTAGCAGAACCTCGGAAGCGGAGAGAAAGCTGCTGGTGTACGAAGCCTTAGAGTACGCAAAAAGAGCTCTAGAAAAAAACGAAGCAAGCTTTGCAGCTCATAAGTGGTATGCCATCTGTATTAGCGACGTTGGAGATTACGAAGGCATCAAGGCTAAGATTGCAAACGCCTACGTTATCAAGGAGCATTTTGAGAAAGCAATCGAACTGAACCCTAAAGATGCTACTTCAATTCACCTAATGGGCATTTGGTGTTACACGTTTGCGGAAATGCCTTGGTATCAGAGGAGAATTGCTAGAATGCTGTTTGCAGCCCCGCCCAGCTCCACCTACGAGGAGGCCTTGGGCTACTTCCAAAGAGCAGAGCAAGTGGATCCGAACTTCTACAGCAAAAACTTGCTTCTCCTGGGAAAGACGTACTTGAAGCTGCACAACAGAAAGCTCGCTGCGTTCTGGCTGGTGAAAGCCAGGGACTACCCCGCACACACCGAGGAGGACAGGCAGATTCAGATGGAAGCCGCTCAGTTGCTTACAAGTTTCAGTGACAAGAATTGAGAATTTTTCAGAGAAGAAAACACATGAAATACCTAGGAACCACCACCTTTTCATCAAATTACAAGTACATTATAACTGTTCTCTGTCTGTTTTCTTGGTTCTTTTAATGTATTTCACAAATCACAAAAGAAATAATTGCCGTGAGCGTGGTCGGGCTGTCTCTGGCTCAGAGACTACTGTGCATTGGGGGCCCCAGCAGTGCAAAGTGGGATCAGATTTGAGGACTGGTCCCATCAGGCTGGGAGGGGATCAGGAAAAGCTTTGTGGGGGAGGTGGCAGTGGGGACTGCATTGCAAGCTGGATGGAGTCAAAGTTGAAATCTTGTCGAGATGGCGAGTGGCAGTCGGGAGGCTGGGAACCAAGGGATTAAGTGATGTGTCTTGGAGCCAGCCTTGTCAGGAGGACTGGGAAGGGACTTGATTTCCTTGTCCCTGTGACTCCACCTCACGGGTGGATTTGTGTCTGGACAAAGCCCAGATCTGGTGCCCTGACGGGGTGGAAGGGAAACCGTGTGGCTTACTGGGGGGGCCGTCAGCACTGCCGACTCGGAGGCTGTGAACAGGAGGACCTCAGACGCCACTTAGATCTGAGTGTACGTGTGTGTGGCCTCTCCCCAGAAGGGGCGGGAAGTGTGTCCCGGTGAACCGCGTGGGTGTGTGCTGTTCGATCATGTGTGTTTTCCAGCAAAAAGGAAGACTGGAGTCTGCACACCTGTCTGATTCACACGTGGACGTGTAGTCTCAGAATTGTAGACAACTCATTTCATCCCTACATACCTGAGCACGCACTGTCTCACAGTAAGGACATCCTTCACAAATCCGTTGTCACCGCTGAAAAGTTAACAGTAGTAGTTTCTCGAATGTCCCAAAATGTCTGTTTTTGAAACCAGGATCCAAACATCATAACGCTGCCTTCGTTTGAAATCGGAAACAGTTCCCCCACCTTTTTTCTCACAGCATTGACTTTGTGAAGAGGCTGGCACAGCTGGCTCAGATTGTCCCTTTTCTAGGTCGGCCGTACGGGACACACCTGGAGACCCC