Transcript asmbl_64908

Sequence
Transcript Sequence for observation asmbl_64908 of TGE0007199:
GCCGCCGGCTTGGTTTGTGAGGAAGGGCCTAGGCCCAGGCCTGCTGTGCTGGGCTCGCTGAGCGCCGGAGCTCGCGTCCTGCTGTCACCTCTACCCCAGCTTCGCCCACAGCCCGTCCCAAACGGGCTGGGCGCAGGGGAGACCTGCCGGAGCCATGGAGGACGAGGTGGTCCGCATTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAACGCGGCTGGAGCACTGGATTTGCTGAAGGAGCTTAAGAATATTCCCATGACCCTGGAATTATTACAGTCTACGAGAATCGGAATGTCAGTGAATGCCATTCGCAAGCAGAGTACAGATGAAGAAGTTACATCTTTAGCAAAGTCTCTCATCAAATCCTGGAAAAAGTTATTAGATGGACCATCAACTGATAAAGATCCTGAAGAAAAGAAAAAAGATACTGCAATTACATCACAGAATAGCCCAGAGGCAAGAGAAGAAAGTAGCTCCAGTGGCAATGTAAGCAGCAGAAAGGATGAGACAAATGCTCGAGATACTTACGTGTCATCTTTCCCTCGGGCACCAAGCACATCTGATTCTGTACGGTTAAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGAGATGACTATATCGCTATCGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAGGAAGCTATATATCAAGAAATAAGGAATACAGACATGAAATACAAAAACAGAGTACGAAGTAGAATATCAAATCTTAAGGATGCAAAGAATCCAAATTTAAGGAAGAATGTACTGTGTGGGAATATTTCTCCTGACTTATTTGCTAGAATGACTGCAGAGGAAATGGCTAGTGATGAGCTCAAAGAGATGCGGAAAAACTTGACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACAGGTGGAACCCAGACTGACTTATTCACATGTGGCAAATGTAAAAAGAAGAATTGTACTTATACACAGGTACAGACCCGTAGTGCTGATGAACCGATGACAACATTCGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTCTGTTGAATTGGAAGAATTGGCAAAATGTCTGGACCATTAAGAAAATGGATTTTGTAATTAGCTTTAAAACTAGGCCAAGGAACTAGGTTTTCTGCAAGTCAGGTTTTTAAAGTGACATACACCCCTTGGTTAGTCTTTGTTTTTGACATAGCATCCTTCCTTAAATGCCTTCTGTAGTTTCAGATCAGTAGGGAGACTACATAATAATTGTATGGTATCCGTTTCAAACATTTCTTTTTCATTTTTATAGGTAATCGATATTAAACTTTTATCAATTAAACTTTTGGCAATTTATTTTTACCTTTTTTCCTTCTTAAAGGGAAATGTACCTTAACTTTTTTACAGTCTGAAACATACACAGTAGAAATGTTATTTTCACTTAACACATAAATGAAAATTACATTTTTTTTCCATATTGGCATGTACCTGCAAATGTTAACAGAGAAGAGAGGTAATATAATTTTAAGTTTATCAACTGTGGTGTGTATTCAAATAATACTTGAGCAGCTCAACTAAATTGTACATAATATTTGAAGTAGCATATGAAATTGGTTTTAATTATTATATTCACAAGTCTGGGATAATTAGATATTTTTTTTTATTTGTAACTAACCGTGACCATCATTTCTTGTAATTTCTTGTACATGTTATTACTTGTTCCTAATAGATTTTACTTTTGGAAACATGACTTGACTTTGTTGAAATCAGTTTGGGTTTGTTGTCTGTTTACCTGTTTGACTTCATAGTGGATTTTAGTTTTGCAGAACACTGTTTAGGTTAGTAGGCTTTTCATAAATCCCAGCACAGGCAGAGAATGAAAGCTCCTGGCAATTTTCTTCCCCTCATAAGAAGACATACTGGGAAGAAAACATTAGCATTTTAGTATAGTGTAATTATAAGTAGTTCATGACTTGATTTTGATTTGGAAATCTATACTGACCAAGGATCAAGTTTAAGGATTATATAAATTCTTTCCATATGGAGGTCGATAGAAAATATTTTTGTCCTAAGTCTAATTGGCTGACTTTTTCTGTTACACAGTGAATGAGGTTGTTGAACAAACTGAATATATGGCCTATAATGCAATTTGTTTTATAGTACAGATCTTACAATTAAGTTTTACTTTTTGTTTAAGTGTGTATCATTTGTTTTGTTAGGATAAGAAAAAAATGACTTTCACTTAGGTTCCTGAGGGCACACTTGCTCTAGTACATCTTAAAGGCCACTGTTACAAAGTTCACATTTTATCATGTTACATCTGTATTCTGTCAGATACCTACAGAAGGACCTAAGTACATGCTTTGCAGTCCCCTTTGTTCCCATATTCTCATTTGTTATTGGAAATAACTTGACGTAATACAGAGACGACATTTAAAGGTCCATGTTAAGACCCCACCTATAAGAATTGGCCCACTGGTATCATTCCACTTCTGCTTTGTCAGTTCACAGATTAATATTTTGTTTTATCATTTGAAAAATAAAGTACATTTTTGAAAGAATGAATTTTAAGAAGAATAAAATTAAAATTGTCCCACTTTTAAATTTAGTGATCCATTTTAAAATTTGTAATTCAAT