Transcript asmbl_64530

Sequence
Transcript Sequence for observation asmbl_64530 of TGE0007193:
AGCTCAAGAGATGGCTGCCCAGTGTGTGACAAAGGTGGAGCTGAATATTTCCTGCGACAATCTTCTGGATAAAGACATAGGGTCCAAGTCGGACCCGTTATGCGTGTTATTTTTGAATACGAGCGGCCAGCAGTGGTATGAGGTTGAGCGCACAGAAAAGGTCAAGAATTGCTTGAATCCCACATTTTCCAAGACTTTCATTATTGATTACTACTTCGAAGTGGTTCAGAAATTGAAATTTGGGATTTATGACATCGACAACAAGACTATAGAGCTGGGCGATGATGACTTCTTAGGAGAATGTGAATGCACCCTTGGACAAATTGTTTCCAGTAAGAAGCTGACCCGACCCCTGGTGCTTAAGAATGGCAGACCTGCGGGGAAAGGCAGCATCACGATTTCGGCTGAAGAGATAAAGGATAACAGAGTCGTCTTGTTTGAAATGGAAGCCAGGAAACTGGATAATAAGGATCTCTTTGGGAAGTCAGATCCGTACCTGGAATTCCACAAGCAGACATCTGATGGCAACTGGCTCATGGTTCACCGGACAGAGGTTATTAAAAACAACTTGAATCCTGTTTGGAGGCCTTTTAAAATCTCCCTTAACTCCCTGTGCTATGGAGATATGGATAAGATTATCAAGGTAGAGTGCTATGACTACGATAACGATGGGTCACATGATCTCATTGGAACATTCCAAACCACCATGACGAAACTGAAAGAGGCCTCCAGGAGCTCGCCTGTTGAATTTGAATGCATAAATGAAAAGAAGAGACAGAAGAAGAAAAGCTACAAGAATTCCGGTGTCATCAGTGTGAAGCAGTGTGAGATTACAGTGGAATGCACATTCCTTGACTATATCATGGGAGGCTGTCAGCTGAATTTTACTGTGGGGGTGGACTTCACTGGCTCCAACGGTGACCCACGGTCTCCTGACTCCCTTCATTACATCAGCCCCAACGGCGTGAATGAGTACTTGACCGCCATCTGGTCTGTGGGGCTGGTCATTCAGGATTACGATGCTGATAAGATGTTTCCAGCCTTTGGGTTCGGAGCTCAGATTCCTCCTCAGTGGCAGGTGTCGCACGAATTCCCCATGAGCTTTAACCCGTCCAACCCCTACTGTAATGGAATCCAAGGCATTGTGGAGGCATATCGGGCCTGTCTTCCTCAGATAAAACTCTATGGACCAACAAATTTTTCTCCCATCATCAATCACGTGGCCAGGTTTGCTGCCGCAGCCACACAGCAGCAGACAGCTTCTCAATACTTCGTGCTGCTCATCATCACCGACGGTGTGATCACGGACCTGGACGAGACCAGACAGGCGATCGTCAGCGCCGCCAAGCTGCCCATGTCCATCATCATCGTTGGCGTCGGCGGCGCTGACTTCAGCGCCATGGAGTTTCTGGACGGTGACGGTGGGGGCCTGCGCTCCCCGTCAGGGGAGACTGCCATCAGGGACATCGTGCAGTTCGTGCCTTTCAGGCAGTTCCAGAATGCTCCCCGAGAAGCGCTGGCTCAGTGCGTCCTGGCGGAGGTCCCCCAGCAGGTGGTGGGCTACTTCAATACCTGCAAGCTCCTGCCCCCCAAGAACCGCACCGCCCAGTGAAAACGCTCCTGCGCCGCACTGCGGGCTGCCCGTTTCCCACGCTCCCCAGCATCCGTGACGGAAACCGAGTCCCCGTGGACTGCGTCTCCTTAAAGCATTCTTTTATACTTTTCTTGGAAGAAAGTGCTAACTTAACCTTTGTCCAATCAATTCAGTGATTGCTAGTGATTAGAGACTCGCACGAGGAAAGCCGCCTTTGCCATGGTGATTGTTTGCTCTCACAGGATGAAGATGCTGGTTGGAACATTCGTCAGTAGAGAGGATGAAGACTTGTTGGGGGTGGGGGAATTTCAGGCCGCTGTGCTTCGTCGGCTCGAGGCCACATGTGCTACAAGTCAGTGTCCGTCCCCGGTGACGGGCGCTTCTCAAAGCAGACGTGCTGAACCTGTCCCTGCAGTTGCTGAGTGCCTGACCCTTGCCCAAGTCTCGCTGCGGCTTAGCCACAGCACAGCTCGCCCCAGCAGCACCCCAAGACTCTCCGAAGAGCGCAGACGAGGACAGGCACCCTTGCACTTCTCAAAAGGAAGAGGAGCCTCAGGAACGTGCGCGGCTGTTCCCGTGTGCCTTTCCAGGACCCGTGTCTGCACGGAGGGCAGGCCGACCGGGCTCAGCGTCAGTAGCGTTTTTTAATTGGAGTTTGTCAGAATGGTTACGACTGCCTAGTCCAGGAAAGCTACGAGGACCAGACGTGTAGAGAAAACTGAGAATCCCTTCCCTTTTAGCCAATGAAGACTTTACTTACTAAGAAAGGACAATTTTTATCCTTGCTGAGGTCCTATACATTGATTAGTACATTTCTTCACATTCGTGTAGACATTTTTTCCTGTTTTCTTTAGTTACTCTTTTAGTCTGGTTTTTAAACTCATGATAGTGGTTGTCTATTAATCAAAATCATATTTTGCATTTTAATAATGTGCTATTTCCTAAGCCCAGAATGTACTGTATTAAGCCTAAAACCTGTTGCAACTTAAAAAAAATAGCCAACATGCTCTAAGAGCAGAATTCCCCCTTTCAGAATACATTACTCAGCAAACGCTGTCAGAACAGTCAGTAATGTTTTATTGAG