Transcript asmbl_64332

Sequence
Transcript Sequence for observation asmbl_64332 of TGE0000273:
AGGTACTAGCTTTTGACAAGTTTGCACCATGCGTGAATATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAATCTGCTCTGACTGTACAGTTTGTTCAAGGAATTTTTGTTGAAAAATATGATCCTACGATAGAAGATTCTTATAGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATTTTGGATACTGCAGGAACGGAACAATTTACAGCAATGAGGGATTTGTACATGAAAAATGGACAAGGCTTTGCGTTAGTTTATTCCATCACAGCACAGTCCACATTTAATGATTTACAAGATCTGAGAGAACAGATTCTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTGGTTGGTAATAAGTGTGACTTGGAAGATGAAAGAGTTGTAGGAAAGGAACAAGGTCAGAATCTAGCAAGACAATGGAACAACTGTGCATTCTTAGAATCCTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGACCTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCCCGCAAAAAGTCATCATGTCAGCTCCTTTAATATACTAAATGCATTGTAGCTCTGAGCCAGGTCTGAGGAATTGTTGCCCAATTCAACAGTGCCAGCATTCCAACTTTGTTAAACCTACCAACATCTTAAATGGACTTTCTGTGGTGGTACCCTTTAAGAGGCGGATGAAAGCTACTACATCAGTTTGCACATTCTAATCACTTTCCAGTATCACAAGAGAGATTTTTACTTACATAATAGTCCTAGAGTATGCAGCTGGTAAAACCAGAGGCTACAATCCAGTATTACTGCTAAGAGACATTTTTCATCCACCAATGTTGTACATGTATGAAAATGGTGTACTGTATACTTTAACACGTCCCATACTTTGTATTGGAGAGTACAATAATGTAAATCCTAAAAGCACCACTATTTTAGCATAATAAAAGAAAGTCCAAAGAGCTCCTATATAGACTACTCCAGATAACTTTGCTTCTTTGATACTTGTAGCTTATTGTAATTTTTTTTAAGAAATTCAAGGTCATTATCATTGTATTGTACAAATAAGCGCTTTGATTAACACAGCTATATAGTTTTTTTAATTTTTAAAAAACCTGTGGAGACAGTGATCTTGTCTTTAAAATATGATAGTCCTTTCAGTATAATGTCTTAGGTTAAAGACGTTGCCTTTAATATCTGTTGGGAAGGAAATGTCCAGACTTTTCAAATCTCTTATTATATGTTTCCTTTTTGTTTACATAGGGAACAATGTTTATAGTTGTGTGTACAGTGGGGGTCTACAACAAGAAGTGTATATTTTCAAACAATTTTTTAATGATTTAACAATTTTTGTAAATCATTTTCAGGCTTCTGCAGCTGTAGATTCTCACTGTGAATCCCTTGCTTGCTCATGCATAAGTGTATTTGCAATACCAAATATACAGGTTTAGTATTTTTGCCTGTTAGTGATTGTTTCACATGTGTAACGTTTTGGTTGAGATGTTAAATGGTGGACGAGTACTGTGGATGTGAATGTGGGAAGTAATTTTAATCATGTGTAATTGGTCACAAGGCCTAATTTGCAGTAACTATTGCTGTTTTATTTAACAATGCCTTGTTGCTTTGTATGCATTAACGTTTGGGTGTAAAGATTGTGTGTCTATCCAACAGGGAGCCACAGTATTTAAATTGACCAACCTAATGTTACAACTACTTTGAGGTGGCCAAATGTAAACTAAAAGCCTTAATTAAAGTGGTGCAATTTTGTATGACTTAGCATCAGTAGTTCAATAAATTTGGATTGCCATGCAAGGGCTTGCATTATAATTACTTGCCACTTGAATGTGTTTTCTGTAATGTTTAACAGTGCTAGTAAATAAATATAGGCTTAACTTTTTCAGTGTACTAGGTGCATTTTACATAGTGTGGTTTCATAATTTAACATTTGGGCAAGCCAAACTTATTAAGTACAGAAATGATGAGTGAAAGATGTCATGTTTTTATCCTAGTATTGTTTGAATATCCACATAATCACCTTTTGAGTTTTTCCTTGGCAAAGAATTTTGTAAATCAAGCAAATTACTTAAGAATATATGCCTTCTGGGTAATGTTCAGTAGCTCTGAGCATAGGAGGAGAATTAAAATACTTTGACAGATATTATGCTTATGAATTTTTAAAAGATACAGGATAAAGTTCGAATATTATGGTTACAAGCCTTTTTGAATGAGGTTGACTCAAAGTACTACTTTCTTTTTAGATAACAGATCTGCCTTTGTCTATGTGTTCTGTAATTCAGTTCTTTTTTGAAACTTGTAAACAAATCTTGACTCAAACTTTGTAAGTATTTGCCAGCCACTGGAGCATAGCAATTAATTCGTGGTAACATCTAGCTTAGGGGGCCTACTAATCCCCTAAATACATGCTATTTGAATGGGATACTTAAAGTCTTTCATTTCAAAAAGAAAAAGGTCTCCTTCCTTATGTATTTCACTCGCAGATTCATGTATTTAAAGGTTCCATGTATCTAAAAAAAAAAGGAATGTTTGTTTTCTCAGAAGTCCTACTTACCGAAGAGACTCCCTTTGGCAAAACTGGTTTTATTTAGAGCCATTGAGAGAAAATTAAACCCCCAAAAAGTGGGATTGTGGAACACTGAAATTACTTCGATTTACTGTCCTGTTACATCCATTTGACCCTCTTTGAGGGCACCCCAATTCAGTTATCTTTGATGTTTGTTGCCTACCAACTATGTACCAATCTGAGTTCTAGGCTCTTAAAAACAAAAATATTCAGCAGATAAAATTTAAGTACTTCTGTGTCAAGCATTGTTCTGGGTCTGAGGATAGAGCAGCAACTGAGATCAACTTAGAACCATGCCCTCCTAGAATTTATACTCTACTGTAGGATTTCTCAGCTGTAGCATTATGGATGTTTTGTACTGGATAATGAGTTGAGGGGGTAGGGCTGCCCTGTGTGTTACAGGATTTTTGTAGCATCCCTGGTCCCCAGCCACTCATTGCCAGTCATACCTTCCCCACCCTCCAGTTGTTTCAACGAAAATTGTCTCCAGACATAACCAAGTGTCTTCTAGCAGATTCAGAGACGGGCAGAGTGGGTGTTGAAGGGCAAAATCACTCCAGTTGAGAACCACTGTTTTAATTACAGGTGAATGTTAGGGGTACAAATGGACAGTTTAGTATAGTGAATAAGAGCATGGGCTCAAACCAAATTTCTGGGGTTTCTAATCCCAGCTCTGCCACTTCCTAGCATGTGACCCTGGTTAGGTGCCTTGATTTCTTTATCTGTAAAATGGGAATGATAATATAACTTGTTATTAATTAAAGAGTAAAGTAAATGCCAGTACCATCCTCTAGATCAAAAAATATATATTTCGATTCTGTATTTTACTAATAGAAATAGGGCTGTGGTTACACAGAAAGTAC