Transcript asmbl_63211

Sequence
Transcript Sequence for observation asmbl_63211 of TGE0007108:
CTCCTCCGAGGAAGGGGGCGGTTGGAGTGGTCTCCATTGTTCGCGGCTTAGGGCGCCATGAGGGGTGACCGAGGCCGAGGTCGCGGAGGGCGCTTTGGTTCCAGAGGAGGCCCAGGAGGAGGGTTCAGGCCCTTTGTGCCGCACATCCCGTTTGATTTCTATTTGTGCGAGATGGCCTTCCCCCGGGTCAAGCCAGCGCCTGATGAAACTTCCTTCAGTGAGGCCTTGCTGAAGAGGAATCAGGACCTTGCTCCTAATTCTGCTGAACAAGCCTCTATCCTTTCTCTGGTGACAAAAATAAACAACGTGATTGACAATTTGATTGTGGCTCCAGGGACATTTGAAGTGCAAATTGAAGAAGTTCGACAGGTGGGATCTTATAAAAAGGGAACGATGACCACGGGGCACAACGTGGCCGACCTGGTGGTAATCCTAAAGATTCTGCCAACGTTGGAAGCTGTCGCTGCCCTAGGGAACAAAGTCGTGGAGAGCCTCAGAGCGCAGGACCCTTCTGAAGTTTTGACCATGCTGACCAACGAAACTGGCTTCGAGATCAGCTCGTCTGACGCGACGGTGAAGATCCTCATCACGACAGTGCCGCCCAACCTCCGGAAACTGGACCCAGAACTCCACTTGGACATCAAGGTGTTGCAGAGTGCCCTAGCAGCCATCCGGCACGCCCGCTGGTTTGAGGAAAATGCCTCTCAGTCCACAGTTAAAGTTCTCATCAGACTGCTGAAGGACCTGAGGATTCGTTTTCCTGGCTTTGAGCCCCTCACACCCTGGATCCTCGACCTACTCGGGCACTATGCCGTGATGAACAACCCCACCAGACAGCCTTTGGCCCTAAACGTGGCATACAGGCGCTGCTTGCAGATCCTGGCCGCAGGACTGTTCCTGCCAGGGTCGATGGGCATCACGGACCCCTGTGAGAGTGGCAACTTCAGAGTACACACAGTCATGACTCTGGAACAGCAGGACATGGTCTGCTACACGGCTCAGACGCTGGTCCGGATACTCTCGCATGGTGGCTTCAGGAAGATCCTTGGCCAGGAGGGTGATGCCAGCTATCTTGCTTCTGAAATATCTACCTGGGATGGAGTGATAGTGACACCTTCAGAAAAGGCTTATGAGAAGCCACCAGAGAAGAAGGAAGGAGAAGAAGAGGAGGAGAATGCAGAAGAACCACCTCCGGGAGAGGAGGAGGAAAGCATGGAGACGCAGGAGTGACCTTGCCTTCACCCTCTTTCTTACCCAAGGGGAAGGAAGACCGGAGCCTAGGCTAACTGCCACTGGGCTTTATATGGTGGCATTTCTGAGGGATGGGGAGACGGGGGAAAAAAAACTCTATGGAAGGAAGTGTCGTCCCACAGACTTCTGCCGTTGGCCTAGTAGCCAGAAGTCCCCCAGTGAAGCAGGATACCAACTTTTCTTCCTTAATACTGTAAACTCCCCAGCTTCCAGAAACCTCTCAACCAGTACTTTGTTGTTGAAATGTGAACTGTTGATGTCTGGAAATTTTTTTCTAGGAAAAATGATTAAAGTACTTCCTAGTAGGGCTCTTGATCTTGTTTTTCCTTGACAATCTAGCAACCTTTGTT