Transcript asmbl_63003

Sequence
Transcript Sequence for observation asmbl_63003 of TGE0007071:
GGCCTTCCTGCCTCGGACGAAAGGAGATCAAGAACTACTCGACCCAGGTGGCTGAGCGCGGAGCGGTGCCACTTTTAGGAATACTCCACGAAAAACCTGCAGGGTGAGCCGGCTTCCAGGAACAGGGCACATTACTCCTCCCTCAGAATGAATGGAGATCAGAAATCGGATGCTTTCATGCAAGAAAAGCAGAATTTCCTCCAGTGTTTCCCAGTGATCATCAAGGTGCTGACCGATGACTTGGAACACCCAGAGATAAAGGAAGTTCTTGCCCGGCTCAAGCAGGTCCTGGAGTACAATGTCATCGGTGGCAAGCATCAGCGGGGTCTGCTGGTGCTGATCGCGTTCCGGGCGCTGGTCGAGCCGAGAAAGCAGGACGCCGCGAGTGTGCATCGGGCCCTGGTGGTGGGCTGGTGCGTGGAGATGCTCCAGACCTTCTTTCTGGTGCTAGACGACATCATGGACTCATCCATCACCCGACGGGGGCAGCTCTGCTGGTATCGGAAGCCAGGCGTTGGCTTGGATGCCATCAACGACGGTCTTCTCATCGAAACGTGTATCTACCGCCTGCTAAAGCACTACTGCCGGGAGCAGCCCTATTACCTGAACCTGATGGAGCTCTTCCTGCAGAGTTCCTACGTGACAGAGATTGGACAGAGCCTGGACCTCATCGCAGGCCTCCAGGACAAGGTGGATCTCTCAGGATTCACTGAAAAGAGGTACAAGACTATCGTCAAGTACAAGACAGCTTTCTACACTGCCTACCTTCCCGTGGCTGCAGGCATGTACATGGCGGGCATCGATGGGGAGAGGGAGCATGCCACCGCCAAGAAGATCCTGTTCGAGATAGGGGAGTTCTTCCAGATCCAGGACGATTACCTTGATGCCTTTGGGGACCCCAGTGTGACAGGCAAGATTGGCACTGACATCCAGGACAACAAATGCAGCTGGCTGGTGGTTCAGTGTCTGCAGAGGGCCTCCCCGGAGCAGCGCCAGGTCCTGCAGGAGAACTATGGGCAGAAGGAAGCCGAGAAGGTGGCCCGGGTGAAGGCGCTCTACGAGGAGCTGGACCTGCCGGGCGTGTTCTCGCGGTACGAGGAGGACAGCTACCGCCGCATCACGGGGCTCATCGGGGACCTCGCCCCGCCCCTGCCCCCTTCCATCTTCCTGGAGCTGGCACACCACTTCTACAAGCGCAAGAAATGAACTGGAGTGTGGCGCGGGGGGGCCCAATAAACGACACAAGTCCTC