Transcript asmbl_63001

Sequence
Transcript Sequence for observation asmbl_63001 of TGE0007072:
GTGAGCCGGCTTCCAGGAACAGGTGAGAGGGTTTGTGACCGGCTCTCGGAGACTGCGGGTGGGGATGTGGCCTTACCTCTGTAGCACAGGGGGCCCGGCCTGTTGCGTCGGAGTCCCCCCCCGTGTTTGGGGTCGATGGGCCCGACTGGCTGACCCTCTGGATACGCGGAAACTCCCGAGCTCTGTCGTGAGCTTTCTAGGCACCCCTAATATGCCCGATCCCGGGTTGCTCCTCTACGACGCGCCCTCCTTCCTCGCCCGGCGTTGCTCCGGGGCTGTCTCCGCTGTCCCGGCGACCACTGTGGGGCTCGGGGCGCCCAGTCTCAGCCCCAGGCTACATGCCGTAGCACGCAGGGGTTCCGGCTCCATTTCTTCTCTTCTTGGGGGCGAGCCCGCACCCCTTTCACCGCCTACCAGGGAAGACCTGGGTTCTAGACCTGTCGCTGCCACTGCCGTCGTATCTCCTTACCTTCTAGAACCTCACTTTGACCAATAAAATAGGGTTACTTAAGGGTCCTCTCAGGCCCTAGTCCTGAGGTACTTTGCTCTTTCTCCAAGACTTGGAGGAAGAAGCCGAGAGTAGCAATTCCAGAGGCTCCCTGGAGGAGGAGTTGGCGGGCGAGGAGGATAACATGAGGTGGCATTAAGTTCTAGCCATCTGTTTTAAGTGTGATCAGTGGAGTCTCAGCCACCCAGCCATCCTTTTGGTTCACTGCATTTCCTTCTTTCTGTAAATGCTCTGAAGCTCAGTCCAGAAGAGGGCGGGGCCAGGGTCCAGAAGTAAAGGGCTAGGGGTGTGTGTATGGGGGTGACCTGGGGAGCTGCCACCGTGTATCTGCCTTTGGTGCTTGCCCCTGCAGGGAGTGCTGGGTGCTTCCTCCCTATGCCACCCCCACATGATGCCCCTGTCCCGCTGGCTGAGGTCTGTGGGGGTCTTCTTGCTGCCAGCCCCCTGCTGGGTACCCCGGGAGAGGTGGCTGGGTACCCTGCGGCGGCCCTCCCTGGTGTATGGGGGCTCAGTCCTGGGGGCCTGGCACAGTGCCGGCTGCTGGTGCCAAGCGTGGACAGAGGAGCCTCGGGCACATTACTCCTCCCTCAGAATGAATGGAGATCAGAAATCGGATGCTTTCATGCAAGAAAAGCAGAATTTCCTCCAGTGTTTCCCAGTGATCATCAAGGTGCTGACCGATGACTTGGAACACCCAGAGATAAAGGAAGTTCTTGCCCGGCTCAAGCAGGTCCTGGAGTACAATGTCATCGGTGGCAAGCATCAGCGGGGTCTGCTGGTGCTGATCGCGTTCCGGGCGCTGGTCGAGCCGAGAAAGCAGGACGCCGCGAGTGTGCATCGGGCCCTGGTGGTGGGCTGGTGCGTGGAGATGCTCCAGACCTTCTTTCTGGTGCTAGACGACATCATGGACTCATCCATCACCCGACGGGGGCAGCTCTGCTGGTATCGGAAGCCAGGCGTTGGCTTGGATGCCATCAACGACGGTCTTCTCATCGAAACGTGTATCTACCGCCTGCTAAAGCACTACTGCCGGGAGCAGCCCTATTACCTGAACCTGATGGAGCTCTTCCTGCAGAGTTCCTACGTGACAGAGATTGGACAGAGCCTGGACCTCATCGCAGGCCTCCAGGACAAGGTGGATCTCTCAGGATTCACTGAAAAGAGGTACAAGACTATCGTCAAGTACAAGACAGCTTTCTACACTGCCTACCTTCCCGTGGCTGCAGGCATGTACATGGCGGGCATCGATGGGGAGAGGGAGCATGCCACCGCCAAGAAGATCCTGTTCGAGATAGGGGAGTTCTTCCAGATCCAGGACGATTACCTTGATGCCTTTGGGGACCCCAGTGTGACAGGCAAGATTGGCACTGACATCCAGGACAACAAATGCAGCTGGCTGGTGGTTCAGTGTCTGCAGAGGGCCTCCCCGGAGCAGCGCCAGGTCCTGCAGGAGAACTATGGGCAGAAGGAAGCCGAGAAGGTGGCCCGGGTGAAGGCGCTCTACGAGGAGCTGGACCTGCCGGGCGTGTTCTCGCGGTACGAGGAGGACAGCTACCGCCGCATCACGGGGCTCATCGGGGACCTCGCCCCGCCCCTGCCCCCTTCCATCTTCCTGGAGCTGGCACACCACTTCTACAAGCGCAAGAAATGAACTGGAGTGTGGCGCGGGGGGGCCCAATAAACGACACAAGTCCTC