Transcript asmbl_6267

Sequence
Transcript Sequence for observation asmbl_6267 of TGE0007136:
CCGCGGTGTCCGGTCCCAGCCTTCTCTGGGAGCGGGCGGTGGGCAACGCCGGGGTGACCCGCGCCCCTCGTTCTTGAGCCCGCGCGCTCTGAGAGGGTGCTCGGACAGATTGAAGCCATGGCTATTCTTTTTGCCGTCGTTGCCAGGGGAACCACCATCCTTGCCAAACACGCTTGGTGTGGAGGAAACTTCCTGGAGGTGACAGAGCAGATTCTGGCTAAGATACCTTCTGAAAATAACAAACTAACGTACTCACACAGCAACTATTTGTTTCATTACATCTGCCAAGACAGGATCGTGTACCTTTGTATCACTGATGATGATTTTGAACGTTCCAGAGCCTTTAATTTTCTGAATGAGATCAAGAAGAGATTCCAGACCACGTATGGTTCAAGGGCACAGACAGCACTCCCATATGCCATGAACAGTGAGTTCTCAAGTGTCTTGGCCGCACAGCTGAAGCATCATTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAACGAGGAGAAAGATTGGAATTATTGATAGATAAAACAGAAAATCTCGTGGATTCGTCTGTCACCTTCAAAACAACCAGCAGAAACCTTGCCCGAGCCATGTGCATGAAGAATCTCAAGCTCACCATCATCATCATCGTCGTATCAATCGTGTTCATCTACATCATCGTGTCACCTCTGTGTGGTGGATTTACATGGCCCCGCTGTGTGTAAAAATAGAAAAGACAAAGTTATTCACCGGACGACACGAGAGAACAAGGAGTTAAAAGGCCGAATGATCTAAACCTTTCACTACTGACAGATGGCGTCTGCCAGTCTCTTCAGCCCTCTCTTTCTCTTTCTGTTTTTAATCCTGTTCTATGCATCCAGATTTATCTTTGTCCTCTCAGTCAGTTTATTCCAGTGTACTTCAAAATGAACCATTTATTGCAGCAGTAGCCTTAAAAAGGCTTTTGTCCGTTCCTTTGGTTTGTTCACTAGTATTATAGACTCAGAGAAACGTTTTCGTCGGTGATTGCACAAAGCCATCGCCAAGGTGGAAAACACCAGTCTTGTAAACTGCCTGCTAAAACTGTAGCTGAACATTGTACGTGCACAGAAAAGTATTCGAGAGACACGTATTGCTACCATCTCATGTTTATGTCTTTTGGTATTGAGGAGTTTTAGATGCTCGAAAACAATACGAATGGAGAATTACTGTTATTTGGGGAATTGTAATTCAATTGTTGGTGCTGCCTGCTTCTAGCAGCCCAAGCAGATAAAGTATTAGACATTCTGTCTTGGTCAGAGGGAGAATATTTTTAGAAGCACGTGGAATTATGTTCGACTTCCTAGTACTCACTTTCAGGAAGAAAGATTTGACCATTTGCAAACCTCACAGAGCTCAGTAGCTTCTGTTTCCCCGTTGCAGTTGATTTGAGAAGATAATGGTTTAAATATGGCCGAAGGTTATGGTTTTCCACATATTTCTTTGGTCCTCAGTTGATTTTTAGAGCCATTCTATAGTTAATAGAATAGACAGTGGAGGGGGTGGGGAGGCACCACAGAGGACACGCTAACGTTTTAGCTCTGTGAATGGAGGCAGCGTGGGAAGGTTTTTCCTTTCTGGGAAAAGCCCAAACAGAACATGGTCAGCTCCAGGGTTTGGGTCTGGCTGCTGTCGAATAATAATAGTCTGAGCATCCTTTGTGGTTCAGTAAGTTCTTTAATCTGCCTACTTTTGAAGAATTCTTTCGTGAAACGAGAGTAGGCACGACGATGTCTAGAAACAACGCAAGACAGTTCAGCATCCATTTAACTGCACTGTAGGAAAACTGCTGTGGATGCTTCGCTTCGGCGACTGTGACGTCTCTCTGCTGGTGTGTACTTTTGGTGTGTATCTGGAAGGACATTTACTGCTCTGGATCTAACTGCATTTATTGATCAATAAATGCCAGTAAGCAGAAATTCTATTATATTCGACTATTTTCCCAATAAAAGAACAAATCAGTCTGTAAAACCTAGCCACCTGTTTAGCCTAGTCACGTGCCTTGAATATATATGTGTCATATAACCTGGCTGATGCTACCTGTTCTTCCACGTAAACCTTTCGGTTCATTAATTGGACACGGATTTCAGGCCCACTGGAACGCTTTTCCTGGCGACCATGCATTCTACAAATGTTCTCTTTATCAACACTAATGCCTTTTAATTGCATCAGCATTTCCTACTGGAAAACACATTTGTTCCAGGAAAACATTTGCCATTCCTGAATAATAATTTCCAAATGTCTTTAATCCAAAGAAGAGGACTTAAAGTGGATTTCCCTTTCGTATACACGACTGAATAAAAATGATGTGCATGTCTTAGGGATAAATGACTTAACTGTCCCTCGATCTGTTTATGTATAAGAATGCTTTTTAAAGCACATATCTTGTTTTAAATGACGCACAA