Transcript asmbl_61811

Sequence
Transcript Sequence for observation asmbl_61811 of TGE0007022:
GTCTGCAGCCGCTGCTGCCACCTCTTACCAGCGCCGTTGCTGCGGGGGATTGTGGGATCCTTCGCGTCCTGTTCGCTAGGAGAGAGAGTTGTCTGCTGGTTCTCAGCTTGAAGAAGATTCTACAGTCCTTATTGATCCTTTTTCTTGGCGTTACCATTTTTTTGAAGCAAAGTTGACCTAGTTTTGTAGTTTGAGCTTTCTTTTTGGCCATCTTTTAAGAAAATTTTTTTGGTAATCTATAAATTAGCCAAGAGATAGTTCTACAATGTCCAAGTCATTCCAGCAGTCATCTCTCGGTAGGGACTCGCAGGGTCATGGGCGTGACCTGTCTTATAGGCCTTCTTGCTGCTGCTACCCAGTCTTTAAGTATGCCAGCATCTCTTGGAAGGATGAACCAGGGTACTGCACGCCTTGCTAGTTTAATGAATCTTGGAATGAGTTCTTCATTGAATCAACAAGGAGCTCATAGTGCACTGTCTTCTGCTAGTACTTCTTCCCATAATTTGCAGTCTATATTTAACATTGGAAGTAGAGGTCCACTCCCTTTGTCTTCTCAACACCGTGGAGATGCAGACCAGGCCAGTAACATTTTGGCCAGCTTTGGTCTGTCTGCTAGAGACTTAGATGAACTGAGTCGTTATCCAGAGGACAAGATTACTCCTGAGAATTTGCCCCAAATCCTTCTACAGCTTAAAAGGAGGAGAACTGAAGAAGGCCCTACATTGAGTTATGGTAGAGATGGCAGATCTGCTACACGGGAGCCACCATACAGAGTACCTAGGGATGATTGGGAAGAAAAAAGGCACTTTAGAAGAGATAGTTTTGATGATCGTGGTCCTAGTCTCAACCCAGTGCTTGATTATGACCATGGAAGTCGTTCTCAAGAATCTGGTTATTATGACAGAATGGATTATGAAGATGACAGATTAAGAGATGGAGAAAGGTGTAGGGATGATTCTTTTTTTGGTGAGACCTCGCATAACTATCATAAATTTGACAGTGAGTATGAGAGAATGGGACGTGGTCCTGGCCCCTTACAAGAGAGATCTCTCTTTGAGAAAAAGAGGGGCGCTCCTCCAAGTAGCAATATTGAAGACTTCCATGGACTCTTACCGAAGGGTTATCCCCATCTGTGCTCTATATGTGATTTGCCAGTTCATTCTAATAAGGAGTGGAGTCAACATATCAATGGAGCAAGTCACAGTCGTCGATGCCAGCTTCTTCTTGAAATCTACCCAGAATGGAATCCTGACAATGATACAGGACACACAATGGGTGATCCGTTCATGTTGCAGCAGTCTACAAACCCAGCACCAGGAATTCTGGGACCTCCACCTCCCTCGTTTCATCTTGGGGGACCAGCAGTTGGACCAAGAGGAAATCTAGGTGCTGGAAATGGGAACCTGCAAGGACCAAGACACATGCAGAAAGGCAGAGTGGAAACTAGCCGAGTTGTTCACATCATGGATTTTCAGCGAGGGAAAAACTTAAGATATCAATTATTACAGCTGGTGGAACCATTTGGAGTAATTTCCAATCATCTGATTTTAAATAAAATCAATGAGGCATTTATTGAAATGGCAACCACAGAGGATGCTCAGGCTGCAGTGGATTACTATACAACCACACCAGCATTAGTATTTGGCAAGCCAGTGAGAGTTCATTTATCCCAGAAGTATAAAAGAATAAAGAAACCTGAAGGGAAGCCAGATCAGAAGTTTGATCAAAAGCAAGAGCTTGGACGAGTGATACATCTCAGCAATTTACCTCATTCTGGATATTCTGACAGTGCTGTCCTTAAGCTTGCTGAGCCTTATGGGAAAATAAAGAATTATATACTGATGAGGATGAAAAGTCAGGCATTTATAGAGATGGAGACCAGAGAAGATGCAATGGCAATGGTTGACCACTGTTTGAAAAAGGCCCTTTGGTTCCAGGGGAGATGTGTGAAAGTTGACCTGTCTGAAAAATATAAAAAATTGGTACTAAGGATTCCCAACAGAGGCATTGACTTACTGAAAAAAGATAAATCCCGAAAAAGATCTTATTCTCCAGATGGCAAAGAATCTCCTAGTGATAAGAAATCCAAAACTGATGGTTCTCAGAAGACTGAAAGTACAAATGAAGGTAAAGAACAAGAAGAGAAGTCAGGTGAAGATGGTGAAAAAGATACAAAGGATGACCAGACAGAACAAGAACCTAGCATGCTTCTTGAATCCGAAGATGAATTACTCGTAGATGAAGAAGAAGCAGCAGCACTGCTAGAAAGTGGCAGTTCAGTGGGAGATGAAACAGATCTTGCTAATTTAGGTGATGTGACTTCTGATGGGAAAAAGGAACCTTCAGACAAAGCTGTGAAAAAAGATGGAAGTGCTTCAGCAGCTGCAAAGAAAAAGCTTAAAAAGGTGGACAAGATCGAGGAACTTGATCAAGAAAATGAAGCAGCGTTGGAAAATGGAATTAAAAATGAGGAAAATACAGAACCAGGCGCTGAATCTGCTGAGAATGCTGATGATCCCAACAAAGATACAAGTGAAAATGCAGATGGCCAAAGTGACGAAAACAAGGAGGACTATACAATCCCAGATGAGTATAGAATTGGACCGTATCAGCCCAATGTTCCTGTTGGTATAGACTATGTGATACCTAAAACAGGGTTTTACTGTAAGCTGTGTTCACTCTTTTATACAAATGAAGAAGTTGCAAAGAATACTCATTGCAGCAGCCTTCCTCATTATCAGAAATTAAAGAAATTTCTGAATAAATTGGCAGAAGAACGCAGGCAGAAGAAGGAAGCTTAAGATGTACAAGAATCTTAATGATTTCAAAAGAAAATAATGGTTCTTTGTTTTTAATGTTAACTTTTTTAAAATACAATACTGATAGTTAGAAGAAAACTATTGTACTCTTTTGTTTTAGTGGAAAAATAATAGATGTCTGTTCATGTGTTAAGTGTTATAGCAAAAATGCATATACGGTTAAGTTAATGAAAAATTGTTTTTGTTTTATCGAAATGGTAACAGACAGAAGTACTTGTAGAGACTGACTTCGTAAACTACTTAAGACAACTTGCACCACTAAGAAAAAGATACGTAGAACTATTCAAAGAAATGAAATTTAGTAGTTCTAAGCTTCAAAGAAATGTCAAAACTTTTGATTCCATTCAATAAAGAACAAAACCAATTGTATTTTTATTACTTTCATCTGAAACATTCCACATTTTAATCTGAGCCTTGTAGACTTCTCATTTGGAGTTTGAAGCTTTTTTGGTTACATTTCATTTTCGGAGAACTTCATTAATGTGTGATTAGCAATTAAAATGCAGGTGCAGTTTTCTTTTAATGTTATGCTGTTGCTTAGGTAATAAGAAATATTAAGTAATTGGCTTTAGATTTTGTAATTTTTTCCCCTAAGTTCCTGCTAGATTTCGTATTCTAGTAGTCAATGTATTTTCAGTGAAATGTAAAAATACTCCCATTCTCTTTGACCAGTATTAATTTCTTGAAACCTTATTGCTTGTCACTTGAATCCTATAGCTGTCATACATCTGGTATAAGCAACATTTGATTTTTGAAGTGTGTAGACCATCTCTTCATATTTTCAAGATGTAATTTTACATTTCTGCATTTT