Transcript asmbl_61526

Sequence
Transcript Sequence for observation asmbl_61526 of TGE0006979:
GGGAGCCCAGGAGGGGGGCGGAGGCGAGGGGAGGCGGCGGCCGCGGCCAGCGCACCATTCGCTCCACCTGATCTCGGGGCGCTGTGCGCTGAGGAAGTCGCGGGCGAGCGGGAGCAGAAGGAGGGAGGGACGCCGCCGCTGCAGCCACCGCCGCCACCATGTCCTACCAAGGCAAGAAGAACATCCCGCGGATCACGAGTGACCGTCTTCTTATCAAGGGAGGCAGAATCGTCAACGATGATCAATCTTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAGCAAATCGGAGACAACCTGATTGTCCCTGGAGGAGTGAAGACCATCGAGGCCAATGGGAAGATGGTGATTCCTGGCGGCATCGATGTCCACACTCACTTCCAGATGCCCTACAAGGGGATGACCACAGTGGATGACTTCTTCCAAGGGACAAAGGCCGCCTTAGCGGGTGGCACAACCATGATCATTGACCATGTGGTGCCCGAGCCGGAGTCCAGCCTGACGGAGGCCTATGAGAAGTGGCGAGAATGGGCCGATGGGAAGAGCTGCTGTGACTACGCCTTGCACGTGGACATCACCCACTGGAATGACAGTGTCAAGCAGGAGGTGCAGAGCCTCATCAAGGACAAAGGGGTTAACTCCTTCATGGTTTACATGGCCTATAAGGATTTGTATCAAGTGTCCAACACAGAGCTCTACGAGATCTTCACCTGTCTGGGAGAGCTGGGAGCCATTGCTCAAGTTCATGCTGAGAATGGGGACATCATCGCCCAGGAGCAAAGCCGGATGTTGGAAATAGGGATAACTGGCCCAGAAGGCCATGTACTGAGCAGACCAGAGGAGCTGGAAGCTGAGGCCGTGTTCCGTGCCATCACCATCGCCAGCCAAACCAACTGCCCTCTCTATGTCACGAAGGTCATGAGCAAGAGTGCAGCTGACCTCATCTCACAAGCCAGGAAAAAAGGAAACGTGGTCTTTGGCGAGCCCATCACTGCCAGCCTCGGCACAGATGGAACCCATTACTGGAGCAAGAACTGGGCCAAAGCAGCTGCCTTTGTGACATCCCCACCTCTGAGTCCTGACCCGACCACTCCTGACTACATCAACTCCTTGCTGGCCAGTGGGGACCTGCAGCTTTCTGGCAGTGCCCACTGCACCTTCAGCACCGCCCAGAAAGCAATCGGGAAGGACAATTTCACAGCCATTCCCGAGGGCACCAACGGGGTAGAGGAGCGGATGTCTGTCATTTGGGACAAGGCTGTGGCCACCGGGAAAATGGATGAAAACCAGTTCGTGGCCGTGACTAGCACGAATGCTGCCAAGATCTTCAACCTGTATCCCCGCAAGGGAAGAATATCTGTGGGTTCTGACAGTGACCTGGTGATCTGGGATCCAGATGCAGTAAAGATTGTGTCCGCCAAGAACCACCAGTCGGCTGCAGAGTACAACATCTTTGAAGGGATGGAGCTGCGTGGAGCCCCTCTGGTGGTCATCTGTCAGGGCAAGATCATGCTGGAAGATGGCGGCCTGCACGTGACCCAGGGGGCTGGCCGCTTCATCCCCTGCAGCCCCTTCTCCGACTATGTCTACAAGCGCATAAAAGCCAGGAGGAAGATGGCAGACCTGCACGCGGTCCCGAGGGGCATGTACGATGGGCCCGTGTTCGACCTGACCACCACGCCCAAGGCGGGCACCCCGGCGGGCTCCACGCGGGGCTCTCCCACGCGGCCGAACCCGCCCGTGAGGAACCTCCACCAGTCCGGATTCAGCCTGTCGGGAACCCAAGTGGACGAAGGGGTCCGCTCCGCCAGCAAGCGCATCGTGGCGCCCCCTGGAGGCCGTTCTAACATCACATCTCTGAGTTAAGCCACCCCTTCCCAAAGAGGGGCAGAAGCAGCAAGAGATTTTTTGAAGCCAAAATGGTACACCGATATTTAAGAAGGAAAGCGAAAACAGTTGCGATCTAAAGAATCAATAAGCCTCAAGCCTTATGTTTCTCCAATGTTACGCTCGCTTGCCTAGCTTTACGAAAATTGCTTTGTTTTCTGTCTGTGCCTAGCCTTGATTTGGTTGACTCCTCCCCCCCATTTGCATGCATGCAATCAGGCCACTAAGGTAAAAGAGTCTGCTATATAGTGTTGAGAGCGTGTGTAGTGCTGCATCTTAAGACAAGGGGACAGACAAAGCTGGATGTCAGGAAAATGAACAAAAGGGACACAGTTATTTGGGGTGAGTGGGTGGTGGGAGCCCAGAGCAAGATGGAGGGTTCAGCGGGGCTGGGGTAGGGTATGTAAGCGGG