Transcript asmbl_14152

Sequence
Transcript Sequence for observation asmbl_14152 of TGE0000263:
CTGGCGGTGCTGACTTCATTCGGGAGGCGGTTGCTGGTGCTGATACCTGTGTATTTGGCCGGGGCAGTGGGACTCAGCGTGGGTTTCGTGCTCTTCGGCCTCGCCCTCTACCTGGGCTGGCGCCGGGTCCGCGACGAGAAAGAACGGAGCCTTCGAGCAGCGAGGCAGCTACTGGACGACGAGGAGCAGCTCACTGCGAAAACTCTCTATATGAGTCATCGAGAGCTACCTGCCTGGGTCAGCTTCCCAGACGTGGAAAAGGCTGAATGGCTCAATAAGATTGTGGCCCAGGTCTGGCCCTTCCTGGGCCAGTATATGGAGAAGCTTCTGGCTGAAACTGTGGCTCCGGCTGTTAGGGGATCTAACCCCCATCTGCAAACATTTACATTTACACGAGTGGAACTGGGTGAAAAGCCATTGCGCATCATTGGAGTCAAGGTTCACCCAGGTCAGAGAAAAGAGCAGATCCTGCTGGACTTGAACATCAGCTATGTAGGTGATGTGCAGATTGATGTGGAAGTGAAGAAATATTTTTGCAAAGCAGGAGTCAAGGGCATGCAGCTACATGGCGTTTTGCGGGTGATACTGGAGCCACTCATTGGGGACCTTCCCTTCGTGGGGGCTGTGTCAATGTTCTTCATCCGACGCCCGACCCTAGACATCAACTGGACAGGGATGACCAACCTGCTGGATATCCCAGGACTTAGCTCACTCTCTGACACCATGATCATGGACTCCATTGCTGCCTTCCTCGTGTTGCCCAACCGATTACTGGTGCCCCTTGTGCCTGACCTTCAAGATGTGGCTCAGTTGCGTTCCCCTCTGCCCAGGGGCATTATTCGAATTCACCTGCTGGCTGCTCGAGGGCTGAGTTCCAAGGACAAATATGTGAAGGGCCTGATTGAGGGCAAGTCAGACCCATATGCACTTGTGCGTTTGGGTACCCAGACATTCTGCAGTCGTGTCATTGATGAAGAACTCAACCCACAGTGGGGAGAGACTTATGAGGTGATGGTACACGAGGTCCCAGGGCAGGAGATTGAAGTGGAGGTGTTCGACAAGGATCCAGATAAAGATGACTTTCTGGGCAGAATGAAGCTGGATGTAGGGAAGGTGTTACAGGCTAGCGTTCTGGATGATTGGTTCCCTCTACAAGGTGGGCAAGGCCAAGTTCACTTGAGGCTAGAATGGCTGTCACTTTTGTCAGATGCAGAGAAACTGGAGCAGGTTCTACAGTGGAATTGGGGAGTCTCCTCTCGACCAGATCCCCCGTCAGCTGCCATCTTAGTTGTCTACCTGGATCGGGCCCAGGATCTTCCTCTGAAGAAGGGGAACAAGGAACCCAACCCTATGGTACAACTGTCAATTCAGGATGTGACTCAGGAGAGCAAGGCTGTCTACAGTACCAACTGCCCAGTGTGGGAGGAAGCGTTCCGGTTCTTCCTACAAGACCCTCAAAGCCAGGAGCTCGATGTGCAAGTGAAGGATGATTCCAGGGCCCTGACTTTAGGAGCACTGACGCTGCCTCTGGCCCGCCTGCTGACTGCCCCAGAACTCATCCTGGACCAGTGGTTCCAGCTCAGCAGCTCTGGTCCAAACTCCAGACTCTATATGAAACTAGTCATGAGGATCCTGTACTTGGATTCATCAGAAATATGCTTCCCCACGGTGCCTGGTTGTCCTGGTGCTTGGGACGTGGACAGTGAGAATCCCCAGAGAGGCAGCAGTGTGGATGCCCCACCTCGACCCTGTCACACGACTCCTGATAGCCAGTTTGGGACTGAGCATGTGCTTCGGATCCATGTATTAGAGGCCCAGGACCTGATTGCCAAAGACCGTTTCTTGGGGGGACTGGTGAAGGGCAAGTCAGACCCCTATGTCAAACTAAAGTTGGCAGGACGAAGCTTCCGGAGCCATGTTGTTCGGGAAGATCTCAATCCCCGCTGGAATGAGGTTTTTGAGGTGATCGTCACATCAGTTCCAGGCCAAGAGCTAGAGGTTGAAGTCTTTGACAAGGACTTGGACAAGGATGATTTTCTGGGCAGGTGTAAAGTGCGTCTCACCACAGTCTTAAACAGTGGCTTCCTTGATGAGTGGCTGACCCTGGAGGATGTCCCATCTGGCCGCCTGCACTTGCGCCTGGAGCGTCTCACCCCCCGTCCCACTGCTGCTGAGTTAGAGGAGGTGCTGCAGGTGAATAGTTTGATCCAGACTCAGAAGAGTGCGGAGCTGGCTGCGGCCCTGCTATCCATCTATATGGAGCGGGCAGAGGACCTCCCGCTGCGAAAAGGCACCAAGCACCTCAGCCCTTATGCTACTCTCACTGTGGGAGATAGTTCTCATAAAACCAAGACTATTTCGCAAACTTCAGCCCCTGTCTGGGATGAGAGTGCCTCCTTTCTCATCAGGAAACCACACACTGAGAGCCTAGAGTTGCAGGTTCGGGGTGAGGGCACTGGCGTGCTGGGCTCATTATCCCTGCCCCTCTCAGAGCTCCTCGTGGCTGACCAGCTCTGCTTGGACCGCTGGTTTACACTCAGCAGTGGTCAGGGGCAGGTGCTACTGAGAGCACAGCTAGGGATCCTGGTGTCCCAGCACTCGGGAGTGGAAGCTCATAGCCACAGCTACAGCCACAGCTCCTCATCGCTGAGTGAAGAACCAGAGCTCTCGGGGGGACCCCCTCACATCACCTCCTCAGCCCCAGAGCTCCGGCAGCGCCTAACACATGTTGACAGTCCCCTTGAGGCTCCAGCCGGGCCTCTGGGCCAGGTGAAACTGACTCTGTGGTACTACAGTGAAGAACGAAAGCTGGTCAGCATTGTTCATGGTTGCCGGTCCCTTCGACAGAATGGACGTGATCCTCCTGATCCCTATGTGTCACTGTTGCTACTGCCAGACAAGAACCGAGGCACCAAGAGGAGGACCTCACAGAAGAAGAGGACCCTGAGTCCTGAATTTAATGAACGGTTTGAGTGGGAACTCCCCCTGGATGAGGCCCAGAGACGAAAGCTGGATGTCTCTGTCAAGTCTAATTCCTCCTTCATGTCAAGAGAGCGTGAGCTGCTGGGGAAGGTGCAGCTGGACCTAGCTGAGACAGACCTTTCCCAGGGTGTAGCCCGGTGGTATGACCTGATGGACAACAAGGACAAGGGCAGCTCCTAGGAGCTGGCGAGTCCCAGCCTGACTGCTCTGTCTTCCTGCCTTCGTCTCGCTCCATCACCGCCTCAATGTGATGAGCCTAAAGCTAGGGTCCAAGGGCAGAGCCTGTGCCCTTCAGCCCTTTCACCTAACAGGCCCATATTCGGGCCTTTGCCTGACCAAAGAGAAGAACCGTATGTTCCCTTTACTGCACGGCCTTTATCCTTCTGGGCCCCTGGGGCGGGGACCTGAGCTGGCTGTTTCCTGCTTTGCCTGCACATTGTTCTCCCTTCCTCCCAACTCCTCAGGGCCTTCTGTATCTGTGCCTGGCCAGTGGCAGCACTAGCAGTGGTATTAGCTTATGCCAAATACAGCTTTGGAAGGATCTTTTTTTCTTTAACTAGATGGTCACCTTCTTCCCTACCACACATGGGTGGGAAGGTGGACAGGCTAACCTCTCCAGCTGTGAGCCTCTTAGACTACTGCATGTAGCAAATGTTCAGCAGCTCAGGCCCCCATGTCCAGTTCTGTCCCCACTGTCCTCAACCCTGTCCTGAAAATTCTACTGCTTTGATGGCTGGGGCCAGTCTCTTGTCACTTTGGAAACTGAGGACGCGTGGATTCTACTCAAGCCTCCAAGTAGTGGCATATCAGTCTTGGAGCTCCTAGCTGGTGATACGGAGAGGGCTTTGGAGGACTTGGGACAGCAGGGCCAATTTTTTTGCCCAAGTGCCTAGGCTGCTAACTCACTGACTAGAACTTAATCTGGTACTTTACAGTTTTGCACCAACTCTGCCAAGCCACTGGATCTTACATTAAACATCATACTCAAACCAG