Transcript asmbl_59942

Sequence
Transcript Sequence for observation asmbl_59942 of TGE0006885:
CCGGAAGTAGCGTGTGGGTCTCTTCCCTTCTGTGGCCATCGCTGAAACTCCAGCGGCCAGTATGAAGTTCAACCCCTTTGTGACTTCTGACCGGAGCAAGAACCGTAAAAGGCATTTCAATGCACCTTCCCACATTCGCAGGAAGATTATGTCTTCTCCTCTTTCCAAAGAGCTGAGACAGAAGTACAATGTTCGATCCATGCCTATAAGAAAAGATGATGAGGTTCAGGTTGTGCGAGGACACTACAAAGGGCAGCAAATTGGCAAAGTAGTCCAGGTTTACAGGAAGAAATACGTCATCTACATTGAACGAGTGCAGCGGGAGAAGGCTAATGGCACAACTGTTCATGTCGGCATTCACCCCAGCAAGGTGGTTATCACTAGACTAAAGCTGGACAAAGACCGCAAAAAGATCCTTGAACGTAAAGCCAAATCTCGCCAAGTAGGAAAGGAAAAGGGCAAATATAAGGAAGAAACAATTGAGAAGATGCAGGAATAAAGTAATCATACACAGTTTTCATTAAAAACTTGTAAATG