Transcript asmbl_58956

Sequence
Transcript Sequence for observation asmbl_58956 of TGE0019917:
CCGCCCCCTGAACCTCGGGTAACGGCGCGAGGGGTCTGAGTACGGTGCGCGGCGGAAGCACGACCAAGTTGGGATGGCCAACAGCTGGGGGAACCTCTTGCAGAATGAGCAGCAGCTGGAGGAACTGGCACAGCAGGCTGTGGACCGGGCCCTGGCTGAGGGAGTGTTGCTAAGGACCTCACAGGAGCCCAGCTCCTCAGACGTGGTGTGCTATCCCATTCACGACACTCTTCCCCTCACTGGTCCCCAGTGCCCTGCTGGAGCAGGCCTATGCCGTACAGATGGACTTCAACCTGCTGGTGGATGCCGTCAGCCAGAATGCTGCCTTTCTAGAGCAAACGCTCTCCAGCACCATCAAAAGAGACGATTTTACTGCTCGTCTCTTTGACATCCACAAGCAAGTCCTGAAAGAGGGCATTGCCCAGACTGTGTTCCTAGGCCTGAATCGTTCAGACTACATGTTCCAGCGCAACGCAGATGGCTCCCCAGCCCTGAAACAGATTGAAATCAACACCATCTCTGCCAGCTTCGGGGGCCTGGCCTCCCGGACCCCAGCTGTGCACCGACATGTTCTCAGTGTCCTGAGTAAGACCAAAGAAGCTGCCAAGATCCTCTCCAATAATCCCAGCAAGGGACTGGCCCTGGGGATCGCCAAAGCCTGGGAGCTCTACGGCTCAGCCAATGCTCTGGTACTACTGATTGCTCAAGAGAAAGAAAGGAACATATTTGACCAGCGTGCCATAGAAATTGAGTTACTGACCAGGAACATCCATGTAATCCGGCGAACGTTTGAAGATATCTCTGAAAAGGGATCTCTGGACCAAGACCGAAAGCTGTTTGTAGACGGCCAGGAAATTGCTGTGGTTTACTTCCGAGATGGCTACGTGCCAAGTCAGTACAGTCAACAGAACTGGGAAGCACGCCTGCTGCTGGAGAGGTCATGTGCTGTCAAGTGCCCGGACATTGCCACCCAGCTGGCTGGAACTAAGAAGGTGCAGCAGGAGCTGAGCAGAGTGGGCGTGCTGGAGGTGTTGCTCCCTGGCCAGCCTGAGGCCGTGGCCCGCCTCCGTGCCACCTTTGCTGGTCTCTACTCACTAGACATGGGTGAAGAAGGGGACCAGGCCATCACTGAGGCCCTTGCTGCTCCTAGCCGGTTTGTGCTAAAGCCCCAGAGAGAGGGTGGAGGTAGGTAGATCACATTTACCGGGCTGCTCAGTGAAAAGGGGCTAGCAGGCTGTCACCAGTGCTGACTGACTGGCACTAGTTATGGTCATAGTCCTAGGCTCTGGGAGATAAAAGAGGGCCTGACACAGACCCTCACCTT