Transcript asmbl_58899

Sequence
Transcript Sequence for observation asmbl_58899 of TGE0006772:
GTTTGCATGAGGCGGGATAGAGACCCAGCCTAGCCGGAGGCTCACTCTGGAGACACGGGAGGGGAGGGGAGGAAAGGAGCTGCCTTGGCTAATAGGGTTGAAATTTCTGATCTTAAACTCTTTGCTGAATATTCTTCTCCCAGAGCCCTGAAGACAAGGGGTAACACCCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATTGATTGCTTTTCTGAGGTGCCCACAAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTGGAGGAGCGGCTATCCTTCTATGAGACCGGAATTTTTCCACGGAAGAACCTGCAGGTTATGAAGGAAGCCATGGTTCAGGCAGAGGAGGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAAGAAAAAAAACGGTTGGCCGCCATTGCTCTTGCATCTCCAGAAAACAGCACTAGTACGCCAGAGGAGTGTGAGGAGATAAGTGAAAGACCCAAAAAGAAGAAAAAGCAAAAGCTCCAAGAGGCTCCTCAGGAGAATGGAATGGAAGAGCCACCTGTCTCTTTAGCCAAACCCAAGAAAAAGAAAGCTTTTTCCAAGGAGGAGCTGATCAGTAGTGATTTAGAAGAAACAGCTGGCAGTGGAAGTCTTCCCAAGAGGAAGAAATCTTTCCCCAAAGAAGAACCAGTTAGTGACCCTGAAGAGGCAGAAAACAGGAGTGTCCCTAAAAAAAAGAGGAAATTTAAGGAGGAGCTGCTCAGCAGTGGACCTGAAGAAGCTGCTAGCAGCAAGAGCAGTAGCTCCAAGAAAAAGAAAAAGCTGCAGAAGCTATCCCAGGGAGATTAGAATGGACAGTGCCCTGGTGGGACATAACCACCCACAGTGACATTTCCCAACCCATCCCTTATATCCCAATAAAAACATTCACAAGCTGA