Transcript asmbl_58897

Sequence
Transcript Sequence for observation asmbl_58897 of TGE0006772:
CGGACCAGCAGCGGGCGCCATGGTGCTGCTGCACGTGCTCTTCGAGCACGCGGTTGGCTACGCGCTCCTGGCGCTAAAGGAAGTGGAGGAGATAAGCCTGCTGCTACCGCAGGTGGAGGAGTGCGTACTTAACCTAGGCAAGTTCCACAACATCGTTCGTCTCGTGGCCTTTTGCCCCTTTGCCTCGTCCCAGGTTGCCTTGGAAAATGCCAACGCTGTGTCTGAAGGTGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACTCACCTGCCATCCAAAAAGAAGAAAGTACTTTTGGGGGTTGGGGACCCCAAGATTGGTGCTGCTATACAAGAGGAGTTAGGGTACACTTGCCAGACTGGAGGCGTGATAGCTGAGATCCTTCGAGGAGTTCGTCTGCACTTCCACAACCTGGTGAAGGGTCTGACCGATGTGTCTGCTTGTAAAGCCCAGCTGGGGCTGGGACACAGCTATTCTCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATTATCCAGTCCATTAGCCTTCTGGACCAGCTGGATAAGGACATCAATACCTTCTCCATGCGTGTCAGGGAGTGGTACGGGTATCACTTTCCTGAACTGGTGAAGATCATCAATGACAATGCTACGTACTGCCGCCTTGCTCAGTTCATTGGGAACCGGAGAGAGCTGAATGAAGAAAAGTTGGAGAAGCTGGAGGAGCTAACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCGCGGTCCTCCATGGGTATGGACATATCAGCCATAGACTTGATAAACATCGAGAGTTTCTCCAATCGTGTGGTGTCTTTGTCAGAGTACCGCCAGAGCCTGCACACTTATCTGCGATCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGCGCACGTCTCATTGCTCATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACTTGCCCACACTCAGGTACCACTTCTGGTGCCCACTGCTTGTTTGGGGATCACAGTGATGGCTGACCAGGGCTTCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGGACCGAGTTTCCAGAGCCCTGAAGACAAGGGGTAACACCCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATTGATTGCTTTTCTGAGGTGCCCACAAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTGGAGGAGCGGCTATCCTTCTATGAGACCGGAATTTTTCCACGGAAGAACCTGCAGGTTATGAAGGAAGCCATGGTTCAGGCAGAGGAGGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAAGAAAAAAAACGGTTGGCCGCCATTGCTCTTGCATCTCCAGAAAACAGCACTAGTACGCCAGAGGAGTGTGAGGAGATAAGTGAAAGACCCAAAAAGAAGAAAAAGCAAAAGCTCCAAGAGGCTCCTCAGGAGAATGGAATGGAAGAGCCACCTGTCTCTTTAGCCAAACCCAAGAAAAAGAAAGCTTTTTCCAAGGAGGAGCTGATCAGTAGTGATTTAGAAGAAACAGCTGGCAGTGGAAGTCTTCCCAAGAGGAAGAAATCTTTCCCCAAAGAAGAACCAGTTAGTGACCCTGAAGAGGCAGAAAACAGGAGTGTCCCTAAAAAAAAGAGGAAATTTAAGGAGGAGCTGCTCAGCAGTGGACCTGAAGAAGCTGCTAGCAGCAAGAGCAGTAGCTCCAAGAAAAAGAAAAAGCTGCAGAAGCTATCCCAGGGAGATTAGAATGGACAGTGCCCTGGTGGGACATAACCACCCACAGTGACATTTCCCAACCCATCCCTTATATCCCAATAAAAACATTCACAAGCTGA