Transcript asmbl_57560

Sequence
Transcript Sequence for observation asmbl_57560 of TGE0010488:
AAAGCACGCTCCTATGGGGATGGAAATTACAAAAAAAAAACAAAACACGTCTCTGCTTCCTTAGATATATCCTATGGCCGTGGTGGCCACTGCAGAGAGAGGACTGATTGTCTATCAATTAGAGAACCAACCTTCTGAATTCAGGAGGATAGAATCCCCACTGAAACACCAGCATCGATGTGTGGCTATTTTTAAAGACAAACAGAACAAGCCGACTGGTTTTGCCTTGGGAAGTATCGAGGGGAGAGTTGCTATCCACTACATCAACCCCCCGAATCCAGCCAAAGATAACTTTACCTTTAAATGTCATCGATCTAACGGAACCAATACTTCAGCTCCTCAGGATATCTACGCGGTCAATGGAATCGCGTTCCATCCTGTTCATGGTACACTTGCCACGGTGGGATCTGATGGCAGATTCAGCTTTTGGGACAAAGACGCCAGAACAAAACTTAAAACTTCAGAACAGTTAGATCAACCGATATCGGCTTGCTGCTTCAATCACAATGGAAACATATTCGCATATGCTTCCAGCTACGACTGGTCAAAGGGACATGAATTTTATAATCCCCAAAAGAAAAATTACATTTTCCTGCGTAACGCAGCCGAAGAGCTGAAGCCCAGGAACAAGAAGTAGGGGAGCCTCCTGGCTGCCACAGCGCCTTCCTCTCCACTCTGCCTCGTCTCACGAACTTGGGTCCCAGCTTTTTGTGGGTTCAGCCATGGATGTGGATTCCAACCCTCGGGGAAAACTGTCATTGTTTGGCAGTCGGGCCCAGCGGGCCACAGTGACCGTTGGTCTCTCCATTCCACTGCCCATTACAGACGTCTCTGGAACTGTGAGGGGGTTGGAGTCGCTGTAGAAGTTAGGTCCCTGCGGGCGACTGCCAGGCATTCGCAGTCTTCGCTCAGCAGCGTGTGTATAGAGAACACTGGGAATCATTTTGTGAACCCTGGACTGTATTTTGTAATAAAGCATTTCGAAGATTGTCTCCTAAGCTCACTGTGTCCACCTTGCCCGCCC