Transcript asmbl_5755

Sequence
Transcript Sequence for observation asmbl_5755 of TGE0006793:
CTTTTCCGCAGCCGGCCTGGGGCGGTGGGAAAGCGAGTGAGGAGAGCGCGACGACGGCGGCGGCGGCGGTGGTGGGTCCATCGCTGGACGGCTAAGGGGAAAGCCAGGCCTGAGCTTCTGCATCTAGGATCAGAATGGTTTCAATCCCAGAATACTATGAAGGCAAGAATGTTCTTCTCACTGGAGCTACTGGTTTCCTAGGGAAGGTACTTCTGGAAAAGTTGCTGAGGTCTTGTCCTAAAGTGAATTTAGTGTATGTTCTGGTGAGGCAGAAAGCTGGACAGACACCCCAAGAGCGAGTAGAAGAAGTCATTAGTGGCAAGCTCTTTGACAGATTGAGAGATGAAAATCCAGATTTTAGGGAGAAAATTATAGCAATCAGCAGTGAACTTACCCAACCTATACTGGCTCTTAGTGAAGAAGATAAAGAGATCATCATAGATTCTACCAATATTATATTCCACTGTGCAGCTACAGTAAGGTTTAATGAAAATTTAAGAGATGCTGTTCAGTTAAACGTGATTGCCACACGACAGCTTATTCTCCTTGCACAACAAATGAAGAACCTGGAAGTGTTCACACATGTGTCAACAGCATACGCCTACTGCAATCGAAAGCATATTGATGAAGTAGTCTATCCACCCCCTGTAGATCCCAAGAAACTGATAGATTCTTTAGAGTGGATGGATGATGGCCTAGTAAATGATATCACCCCCAAATTGATAGGAGACAGACCTAATACGTACATATACACAAAAGCATTGGCAGAGTATGTTGTACAACAAGAAGGAGCAAAGCTAAATGTGGCAATTGTAAGGCCATCAATCGTTGGTGCCAGTTGGAAAGAACCTTTTCCAGGATGGATTGATAACTTTAATGGACCAAGTGGTCTCTTTATTGCGGCAGGGAAAGGAATTCTTCGAACAATGCGTGCCTCCAACAGTGCCCTTGCAGATCTCGTTCCTGTAGATGTAGTTGTCAACATGAGTCTTGCGGCAGCCTGGTATTCCGGAATTAATAGACCAAAGAACATCATGGTGTATAATTGCACAACAGGCAGCACTAATCCTTTCCATTGGGGTGAAGTTGAATACCATGTAATTTCCACTTTCAAGAGGAATCCTCTCGAACAGGCCTTCAGACGGCCCAATGTAAATCTAACCTCCAATCACCTTTTATATCAGTACTGGATTGCTGTAAGCCATAAGGCGCCAGCATTCCTGTATGATATCTACCTCAGGATGACTGGAAGAAGCCCAAGGATGATGAAAACAATAACTCGTCTTCACAAAGCTATGGTGTTTCTTGAATATTTCACAAGTAATTCTTGGGTTTGGAATACTGACAATGTCAATATGTTAATGAATCAACTAAACCCTGAAGATAAAAAGACTTTTAATATTGATGTGCGGCAGTTACATTGGGCAGAGTACATAGAGAACTACTGCATGGGGACTAAGAAATATGTTTTGAATGAAGAAATGTCTGGCCTCCCTGCAGCTAGAAAACATCTGAACAAGTTGAGGAACATACGTTACGGTTTCAATACTATCCTTGTGATCCTGATCTGGCGTATTTTTATTGCAAGATCACAAATGGCAAGAAACATCTGGTACTTTGTGGTTAGTCTGTGTTACAAGTTTCTGTCATACTTCCGAGCATCCAGCACTATGAGATACTGAAGACAAGAATTTAGCATTAGAACATCTATGCATATGGTGGTCTAAATGCACAAAACGTAAAATGTACTTAAGTCATGTCATCTTTTGTCAAGACATTAAACCATCTTAGATCAGAGAGTGGAGTAAATTATGGTACATTTTATGTAACGTTTTAATGTTTATGCTCTTAAAAATCTAGTGAACACACTGTGGTATGCCATCTCAATTCTGCAATAGCCACCAAAACCATGACTTAATATTTTGATCCCTCGGGAAAAGGGGTGGGGTGAGGGTAGGAGTGGGGATATAGGAACACTGACCAGTATAACTGTGCAATTCTGGAACATATTAATTAAAATATGCCTTAACATATAGTGAATTTCTAATTCTAATATTGAATGCAATGGAAAGCATTTATTTGGACAGGAATACGAGCTAAGTTGGTAGATATTTGATTCTTCAGTGTTTAATTTTTTTCATCAGTCGATGTGGGTTTTAGTTTTGTTCAAGTTATAGCCAAACTATTTTCACATCATCCTGTAAGTTATCGAGTGGTCTCAGACATGAAAGATGTGTTCTCATTTTTCTTTCTCTGATTAGAGGTCTCATGCATATCATTTTTCTATAAGCAATCAGTTGCTTTCATAATCAGAAGGCTATAATTATTCTAAAGATCCTAATAGATCGAAATGGGCTTGAAAATCCATATCAACATATGCTATGTGTTTTTTGAAGGAAAATTAAAATGAATTCAGTAAGACTTGGCATCAAAAATTAGGATACATTTTTTTGTTCACATTATGGCAAATAAAAATCCTGTGAGATGTTGTTCATGTTTTTAAGATGGAGGATTTCTTGAGACTTTGGCAAATGGGGGTGGGGGGGGC