Transcript asmbl_57544

Sequence
Transcript Sequence for observation asmbl_57544 of TGE0006711:
CGGCTAGGGCGGCGGTAGCGGCGGGAGCCGAGGCTTGCAGCGGGACTCCCCGCTGAGAGCGCGACGCGGCCTTGAGCGGCAGACGGCGCAGTAGGCCGAGGGGGAGGCGCGGCAGCCGCCCTGGCCCGTCATGGAGATGGAAAAGGAGTTCGAGCAGATCGACAAAGCCGGGAGCTGGGCGGCCATTTACCAGGATATCCGACACGAAGCCAGTGACTTCCCGTGTAGAGTGGCCAAGCTTCCCAAGAACAAAAACCGAAACAGGTACAGAGATGTCAGTCCCTTTGACCATAGTCGGATTAAACTTCATCAAGAAGATAACGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGAAGTTACATTCTTACCCAGGGCCCTTTGCCTAATACGTGCGGCCACTTCTGGGAGATGGTATGGGAGCAGAAGAGCAGGGGCGTGGTCATGCTCAACCGAGTGATGGAGAAAGGATCGTTAAAATGTGCGCAGTACTGGCCACAAAAAGAAGAAAAAGAAATGGTCTTTGAAGACACAAATTTGAAATTAACATTGGTCTCCGAAGATATTAAGTCATATTATACAGTACGACAACTAGAATTGGAAAACCTTTCATCTAAAGAAACTCGAGAGATCTTACATTTCCACTATACCACGTGGCCTGACTTTGGAGTCCCCGAATCTCCAGCCTCTTTCCTGAACTTTCTTTTCAAAGTCCGCGAGTCGGGGTCACTCAGCCGGGAGCATGGCCCCATCGTGGTACACTGCAGCGCTGGCATCGGCAGGTCGGGGACCTTCTGTCTGGCCGACACCTGTCTCTTGCTGATGGACAAGAGGAAAGACCCTTCTTCTGTCGATATCAAGAAAGTCCTGTTAGAAATGAGGAAATTTCGAATGGGACTGATCCAGACAGCAGACCAGCTCCGTTTCTCCTACCTAGCTGTGATCGAAGGTGCCAAATTCATCATGGGAGACTCTTCAGTGCAGGAGCAATGGAAGGAGCTCTCCCACGAGGACCTGGAGCCCCCACCTGAGCATGTCCCCCCACCTCCCCGGCCACCCAAACGAATCCTGGAGCCACACAATGGGAAATGCAAGGAATTCTTTCCAAACCACCAGTGGGTAAAGGATGAGTCTGAGGAAGATAAAGAAGATGGCCCCATCAAGGAAGAAACCATAACACCCTTAAGTGTCCCCTGCATGGAACGCACGAGTCAAGACACTGAAGTCAGAAGGCGGGTCGTGGGGGCAGGTCCTGCTCAGGGGGAGCCGTCGCCACCCAAGGAGGAGCAGGACCAGGCTCTGACTCACTGGAAGCCCTTCCTGGTCAACATGTGCATGGCCACGGTCCTCACAGCTGGCGCGTACCTCTGCTACAGGGTATGTTTTCACTGACGGACGTGCCGGCAAGACCACGTGTACAGAAAGCACTGGCCGACAGCCTGGCGGTAGCATTCAGTGCTGTGCAAGGATCTGAGCCAGTCTCAGAAGAAACAGATCAAAGTTTTTTAAAGTCTGGAACTGTGAAGGGCTAACAAGAGAGAATTGAGGATTGATGCACTGGGGTTTTAAGGAGCCCTGTGGTCCCAAGAATACAACAGTCTAATCTCAGGGCCTTAACCTATTCAGGAGTAAGTAGAGAAAATGCCAAATACATCTCTCTCTCTTCATTTTTCTTTCTTTCTTTTTCTTTGTTTTTTTTTGTTTGTTTGTTTGTTTTT