Transcript asmbl_57204

Sequence
Transcript Sequence for observation asmbl_57204 of TGE0006647:
CCCGTCTCCTCGAATGAAAGGAAACAACCTCCGGCGACAGAGCCCCGCTCTCAGGCGCTGCCGGAGAACCGAGACCGACTTCTTTCTCTTAACCCTCATTGGCGCTTCTCCTCTGCCGTTCGCCTCTGGGCCCCGCCGCATTTCTTGAGGCCTAAAGTGGCATTCTAAAGGCAATTTAAAAATCATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAATAGAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCACACCATAAGTGCATGCTCTTTTCATCTGCTTTGGTATCATCACACTCTGATAACGAAAGTCTTGGTGGATTTTCTATTGAAGATGTCCAAAAGGAAATTAAAAGAGGCATGAAGCTGATGTGTTCTTTGTGTCATTGTCCTGGAGCAACAATTGGTTGTGATGTGAAAACCTGTCACAGGACATACCACTACCACTGTGCATTGCACGATAAAGCTCAAATACGAGAGAAACCTTCACAAGGAATTTACATGGTTTATTGCCGGAAACACAAGAAAACTGCACATAACTCTGAAGCTGATTTAGAAGAAAGTTTTAATGAACATGAACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCAAAGGAAGACCACGAAAAACTAATTTTAAAGGGCTGTCGGAAGATACCAGGTCCACATCCTCCCATGGAACAGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCACACAGAAGCAGCCCTAGTGACACCAGGCCTAAATGTGGATTTTGCCATGTAGGAGAGGAAGAAAATGAAGCAAGAGGAAAACTGCATATATTTAATGCCAAGAAGGCAGCTGCACATTATAAGTGCATGTTATTTTCTTCTGGCACAGTCCAGCTCACAACAACATCAAGAGCAGAATTTGGAGATTTTGATATTAAAACTGTACTTCAGGAGATTAAGCGGGGGAAAAGAATGAAATGTACACTTTGCAGTCAGCCCGGTGCTACTATTGGATGTGAAATAAAAGCCTGTGTTAAGACTTACCATTACCACTGTGGAGTACAAGACAAAGCTAAATACATTGAAAATATGTCACGAGGAATTTACAAACTGTATTGTAAAAATCATAGTGGAAATGATGAGAGAGATGAAGAAGATGAGGAACGAGAGAGTAAAAGCCGGGGAAAATTAGAAATTGATCAGCAACAACTAACTCAGCAGCAACTTAATGGAAACTAGGTATGAAAGTTAATTATATCGGATCTGTTGTCAGAATACAATACACATTGATAAAAACATGTTGAAATAATGGTGTGCAGTATGATTTTTTAATGCTATTGTGTTTAGTTAAGCATGTTATTAGAATACTGAGGATTGTGTAGGCTTGCATAGTTTTTTAAACTAGCTGATTTTGTAACAATAAAAACAAGCTATCCAATTTATCAATAAATGTAGTTGTAATGTCAAATCAGTAAGATATTCTCGCTCCCCAATAACATTATATTTATTGTGTTCCCCTCAAGCATCATATTTTACATTTTTTTATCATCTTTTAAACAGGTTCATGGGACAGAGTTAGAAAACTGGGAATGAATAAGACATCCATAACTACTATTCTTTTTTCACTGTTTTCTAAAATCAAAAAGGGTTTGTAACTTTTTACTGCCCAACTCTTAGATCCTTCATTGAACTGCCTAAAAACGTCTTGTTTTATGAGCCTTCTTCACTAGATGGCAGAGTTTGACATGTTGATATTACGTAGCTGTAGTTTGCAGTTTCTGGGAAGCGATTGAAACACTATTAACCCTGTGTATAGTGTCAACAGTTAAAGCAGACATTGAAATGAAGTAAGCTATATTTCTGGACCGAACAAAGTTCTGCTGTTTAGAGTGTCTAAGTTTGCTTAGTGGATTCATACTCAAAGGAAAGTATAAGCAAATTTCACTTAACAGTGCAAACATGCCTCTGGTGGCAACATGTGGGAATTTGTGGAATTTTTTTTCACACGCAAGTAATGGAGGCTAGAAATGAAGAGAACTTTATTTTTCCCTTGGCTTTGACAGCAAATGCTTAAAATCTCTTCCAAGAAGTGTGCTAAGCTTTTCATTTGGTTCCTGTTAAAGTTGTTCTCACTGACCAGCATGGACTTGGGCAACTGGTGATTATAAGCTATGAGCTCCAGTGCTTATGCCAAAATTATCTTGACAGTAAACCTCTTTTCTTTTCATGTCATACAAAGAGCTTCTAGCAAAATGATTGGATCCTTTCGAGTTTAAACTAACATTTGGCGACAGCAAATTAAACCTCTTTAAGACTCACTAAGGACTTTAGCCACCATGTCTGAAACCTGTTCCTCTCAAGTGCCGTGTTGTGTGGAACACTTCTTATATTGGCCCAAAGTATGTAAGGAGGTCTCATGTGCTCTAGGAGTAAAAAAACAGTCTTCGCATAAAACAGTATTTATTTTTAATTTTGTGACCACTATTTTAGAAACTTTATTTAATGTTTTTAATGTTTCATTCAGTGCTTTGCTTATCTAGTAAATAGGCTTTTGTGCCCTACTTTTCCTCTGGTAGGGCTTGCTGTTGTACTATTGATCATCAGAATTGTTTCTCAAAGCCTAAGAACCCAGCATTTTAGAAAGGATTTTCACACTGGCATTTCTAGCTAGTGTTATTTTCTTCCACTTACTTGCTGAAGCACATTTATATATTTCTTCATGGCAAAACCAAAAAACTTTAGTTGTGGTCTGCCTAATATTACCATAGCACCTCATTTATCAAGGGTAGGGATTCTGATCATTGAATTATTAGTTAATTAAATTAAATCAGCAGGCAAATAATCATGTTAACTTGACTGCACATCAAGATATTCTACAGCTTATGGAAAAGCATTTTAAAAATGTAACAGGTGGAAAATTACACTGTGCTTAATGACTGATTTTTTTTTAACTGCTAGTCCCTTAAAGTCATATTTGTCAAGTGTGTATTCACACATTTACTTAAATCAAGGGACTCGATTGCTTTATTTTAATCATCTTTTATTATTTTTAGAAGGAAACTAGCTTTAGTAGTGAGTTGTCTTCCCTATATGTTTTTCTCTTCTTGCTCTAAATATGCCATTGGGTTTCTTTGTGTGTATGTGATGAATTTTCAAAATTCACCGTGACTTGAAGTGCAACGACAGATCTAGATGTTTGTTTACCAAGCTATGTGACTTTTCCCAAAGGATCTGTACTTTATTTCCTTACAACAGCTTGAAACCCGTTATTTTAAATCTTTGAATCACTGTGTCTAGATCATTTTTACATTGTGTGCCATTGATTTACCCGTGGAACTATAGAGCACCTTCATTTTTGGACAACTACTGTAATGATGTTTTTAGGAAAAATAGAAGGTGCCAGGGGTAATAATGGCCAGTCAATAATCACATAATGGACTTCAAATACTATAGCTGTCAGTTGATGGATTTGTTATGTAATAAAGTGTATGATTTTTGTATGGGTTTCTTCAACCCTTTCTGCCACTAGCAACCAGAATAGCACTTTTACCTTTTGGTTGGCTAGGTAAGTGGCTGGCTACCTATTTTTCTCACTGTGGTGTGATTGGCTAAATAGTCTTTCATTAAAAATTAAAATGTAAATTGAAGTCACACGAAAAATCATGTTTGGTTGTAAACCGCCGATATTTTGTTTTTCTA