Transcript asmbl_56043

Sequence
Transcript Sequence for observation asmbl_56043 of TGE0006626:
GGAAGTGGCCGGGAGGCAAAGGCCGAGCCCCTTCGGTCATCTCCGGCGCTTCAAGGGGCGTTTCCTGTACTCTTCGGTGCCGTGGAGGTACTAATTTAAGAGATGCCCCTTTTATTAATTTATTTTCAAACCCAAAAAAAAGCCACGGATGATTTATGGGCCATTTAATTCAGAGCCCTGGTTTTTACGTTGAAGAGTGAGATTAACATACTTTGACCTTTAACCTTCGGCACGGTGCGGCGGAGGGAAACGCCTCCGTCTCTATATAAGGAATTTCCCGGACTCTTGCGGCCTCTTTTTTTCCTCTTAACGTTCAGCGAGAACTGCAAACGATCCTGTTTCCTCCGCTGCTGCCCAGTTGCCGGACCAGCAAACGCCATGGGTTTTGGAGACCTGAAAAGCCCCGCTGGCCTCCAGGTGCTCAACGACTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTACCATCACAAGCAGATGTAGCAGTATTTGAAGCAGTCTCTGGCCCACCACCTGCCGACTTGTACCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCTGGAGTGAAGAAAGCTTTGGGCAAATATGGCCCTGCTAATGTGGAAGACACCACTGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTGAAAGACA