Transcript asmbl_55941

Sequence
Transcript Sequence for observation asmbl_55941 of TGE0006607:
AGAGTTTCCGCCATTTTTGAAAATTGAGAAAGTCCGGAGCTAGGAGTAATTGCAGCCGCGATGGCAGCCTTTGCTGTGGAACCCCAGGCGCCCACGCTGGGATCTGAACCAATGATGCTGGGTTCACCCACATCTCCAAAGCCAGGGGTTAATGCCCAGTTCCTACCTGGATTTTTAATGGGGGATTTGCCAGCTCCAGTGACTCCACAACCTCGAACAATTAGTGGCCCTTCAGTAGGAGTAATGGAAATGAGATCACCTTTGCTTGCAGGTGGGTCACCACCACAACCAGTTGTACCAGCTCATAAAGACAAAAGCGGAGCTCCACCAGTTAGAAGTATATATGATGACATTTCCAGTCCAGGACTTGGATCAACACCTTTAACTTCAAGAAGACAGCCAAACATGTCATTAATGCAGAGTCCTCTTGTTGGAGTTACGACAACTACTCCTGGGATAGGGCAAAGTATGTTTAGTCCAGCAAACATTGGACAACCACGAAAGACAACGTTATCTCCTGCCCAGTTGGATCCTTTTTATACTCAAGGAGATTCTCTGACTTCTGAAGATCACCTCGATGACACATGGGTGACTGTGTTTGGGTTTCCTCAAGCATCTGCTTCCTATATATTATTACAATTTGCACAATATGGGAATATCTTAAAACATGTGATGTCTAACACAGGAAATTGGATGCATATTCGTTATCAATCTAAACTGCAGGCTCGGAAGGCCTTAAGCAAAGATGGGAGGATTTTTGGAGAGTCCATCATGATTGGTGTAAAACCATGTATAGATAAAAGTGTTATGGAAAACAGTGACAGGTGTGCTTTGTCATCCTCACCTCTGGCCTTTACACCACCAATCAAAACCCTAGGTACACCAACCCAATCTGGAAGTACTCCTAGGATTTCTACCATGAGACCTCTTGCTACAGCATACAAAGCTTCTACTAGTGACTATCAGGTCATTTCTGACAGACAAACGCCGAAAAAAGATGAAAGTCTTGTATCCAAAGCAATGGAGTACATGTTCGGCTGGTAGTGTAATAACAGCTAAGAACTGAACTACAAAGGAGGAGGCTGCTACACTAAAACAGTTAGCAGAGTACTGCCAGGTTTCCTTGGGTTAATTATATAACCACTCTCGGCAGTATTGGATAGCTATCTTATACTTTCTTTAGAAGCCTTTTTCTTTAAGGATACAACATATTTGTAGCTCGCACTTTAAAAGATGATTGAGATATGTTTTAAAGAAACAAAAACTCCCTGTAAACAGGATTTTGTGCTTTCTGTAGTAGTGCATGCTTAAGCACAAAAAAACTCAGCATTGATTACTATAAAGTATATAATTGAGTTTGAGATGAAGCTTTGTAGTCTTCTTGAGTTGGTAAGGAGAATTTCATGAAGGGTAACTGTACAGCTGCTTCTAACAAAACACAGTTTATAATTAACAATTTGAATTATGGCCTTTTAATTTAGATAGTATTTAATATTTTAATTATCCTTGTTTTTATATGTCCTATCATGGACTGTCATCTTTCAGTATTCTTAAAAAGCCAGAACAGTCTTTTTAAAAACCTACTA