Transcript asmbl_55713

Sequence
Transcript Sequence for observation asmbl_55713 of TGE0006559:
GGCGTTCTCTAGCCGACTCCTGGTCCCTGGGGTTTAAAGGAGATAAACTGCACTCAGCTGAGTGCAAGATTAAGAGGAATTGATTAGAAGTTGACTCTAAAGGTTTATTGCAGTCAAAATGTCTCAAAAAATCCGTGGTGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGGGAGTTGATTAAAGAAAAACTCATTTTTCCATATGTGGAATTGGACCTGCACAGCTATGATTTAGGCATAGAGAATCGTGATGCCACCAATGACCAGGTCACCAAGGATGCTGCAGAAGCTATAAAGAAGTACAATGTTGGTGTCAAGTGTGCTACCATCACCCCCGATGAGAAGAGGGTTGAGGAGTTCAAGCTGAAACAAATGTGGAAGTCACCAAATGGCACCATTCGAAATATTCTGGGTGGCACTGTCTTCAGGGAAGCTATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCCATCATCATAGGTCGTCACGCTTATGGGGATCAATACAGAGCAACTGATTTTGTTGTTCCTGGTCCTGGAAAAGTAGAGATAACCTACACACCAAGCGATGGATCCCAAAAAAAGACGTACCTGGTTCATAACTTTGAAGAGGGTGGTGGTGTTGCCATGGGGATGTACAATCAAGATAAGTCAATCGAAGAATTTGCACACAGTTCTTTCCAGATGGCTCTGTCTAAGAGTTGGCCTTTATATCTGAGCACCAAGAACACTATTCTGAAGAAATATGATGGACGTTTTAAAGACATCTTTCAGAAGATATATGACAAACAGTACAAATCCCAATTTGAAGCCCAGAAGATCTGGTATGAGCATAGGCTCATCGATGACATGGTGGCCCAAGCTATGAAATCAGAGGGAGGTTTTATTTGGGCCTGCAAAAACTATGATGGTGATGTGCAGTCAGACTCCGTGGCCCAAGGTTATGGCTCTCTTGGCATGATGACCAGCGTGCTGATTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCATGGGACTGTAACACGCCACTACCGCATGTACCAGAAGGGACAAGAGACATCCACCAATCCTATTGCCTCCATTTTTGCATGGACCAGAGGGTTAGCCCATAGAGCTAAGCTTGATAACAATAAGGAGCTTGGCTTTTTTGCAAAGGCTTTGGAGGAAGTCTGTATTGAGACCATCGAGGCTGGCTTCATGACCAAGGATTTGGCTGCTTGTATTAAAGGTTTACCCAATGTGAAACGTTCAGACTACTTGAATACATTTGAGTTCATGGACAAACTCGGAGAAAACTTGAAGACAAAACTAGCTCAGGCTAAACTTTAAGGTCATTCCTTGACTTGGGAGGACACGTGTTTTTTTGGTAATTAGGTCCACTGGTTTACATTTTTCTGTATAACACTCAAGAGTATGGGCAAAATCAATTTTCTAATTTGTTTAGAAGTCAGAGTTTATCTTTTCTATAAGATTACAGTCTTTTTCTTATACATACAATTATGCCACCTTCATGAATGTGGCTGGGAACTTTTTAAAATTTTATTTTCTATTAGTAGCTTAGGAATTACTTTAGTGCTGATTTGTACTCACTGTCACTTTTTCTCATGTTCCAGTATAAATGACCAAAATGAAGAGTGCTCGAAAGGGTAAACTATAGCCATGGTATTAGTCCCTAAAATTGTATAAAGTAGAAATTCGCTCCCTTCCCCACTTTTCCATGGCCTGGGGCTCTGGGTGGTTTTGCTGTAACAGGTGTCCCATCCTGTGTGGTAGAGCTGTACCTTAAAAGTTGCCCATGAGTTGGAATGAAGAGCATGGTTATAACTAAGACACAGCAGTCATATATGTAAAGAGCTCTGATTGAACGTTTCGAAAAGGCTAAAGATTTTTGAAGCCACTAAGAGTGTTTGGAATCTAGAATAAATACTACTCGGGGGTTTGTCCTCTGCGTTTGTCTCCTCCTCCTGGCCCTGTGTGGCTTAAGTATTATACTGCCCTGAACAGCATATTTCATCTAAGTGCAATAATACAAGCTGCACCTTTTTTGTACTTCTGCTGGCCTGTTGGGTTTTTTTTTTATATAAATGTGACTTTTTAGAAATTTGTTTTAAACACTATACTAGTCTGTTCTTCATCTAAACTATTAATTAAAGTTAAGTGCTAATGACTAATCTGAGTTTTTATTTATCAAGTGTACTTTAGTTGCCATAGGAATTTGATTTTGAAAAGTCTCTGCCCTCAAGGAG