Transcript asmbl_55592

Sequence
Transcript Sequence for observation asmbl_55592 of TGE0019778:
GGCATAATCGAAAGAAGCATCTTAACTACACAGAATTCACACAGTTTCTCCAGGAGCTACAATTGGAACATGCAAGACAAGCCTTTGCACTTAAAGACAAAAGTAAAACTGGCATGATTTCCGGTCTGGATTTCAGTGACATCATGGTTACCATTCGGTCTCACATGCTTACTTCCTTCGTGGAGGAGAACTTAGTTTCAGCAGCTGGAGGAAGTATCTCACACCAGGTTAGCTTCTCCTACTTCAATGCATTTAACTCCTTACTGAATAACATGGAGCTTGTTCGTAAGATATATAGCACTCTAGCTGGCACAAGGAGAGATATTGAAGTCACAAAAGAGGAATTTGCCCAGAGTGCCATACGCTATGGACAAGTCACTCCATTAGAAATTGATATCCTATACCAGCTTGCAGACTTATATAATGCTACAGGGCGCTTGACTTTGGCAGATATTGAGAGAATAGCCCCGTTGGCTGAGGGGGCCTTACCTCACAACCTGGCAGAACTTCAGAGACAGCAATCTCACGGTTTAGGCAGGCCTGTGTGGCTCCAGATTGCCGAGTCTGCTTACAGATTCACTCTGGGCTCAGTTGCTGGAGCTGTGGGAGCCACTGCAGTATATCCTATAGATCTGGTGAAGACGCGCATGCAAAACCAGCGTGGTACTGGCTCTGTTGTGGGGGAGCTGATGTACAAAAACAGCTTTGACTGTTTTAAGAAAGTCTTGCGTTATGAGGGCTTCTTTGGACTCTACCGAGGTCTGATACCACAGCTTATAGGGGTTGCTCCAGAAAAGGCCATTAAACTGACTGTTAATGATTTTGTTCGGGACAAATTTACTGGAAGAGATGGCTCCATTCCACTTTTTGCAGAAATCCTTGCTGGAGGTTGTGCTGGTGGCTCTCAGGTCATCTTTACCAACCCATTGGAGATAGTAAAGATTCGCCTGCAGGTAGCTGGAGAGATCACTACAGGACCCAGAGTCAGTGCCCTGAATGTGCTCCGAGACCTGGGACTTTTTGGTCTGTATAAGGGTGCCAAAGCGTGTTTCCTCCGAGACATTCCCTTCTCTGCAATCTATTTTCCTGTTTATGCTCATTGCAAAATACTTCTGGCTGATGAAAATGGACACGTGGGAGGTCTCAATCTCCTTGCAGCTGGAGCCATGGCAGGTGTGCCTGCTGCTTCTCTGGTGACCCCTGCTGATGTCATCAAGA