Transcript asmbl_55505

Sequence
Transcript Sequence for observation asmbl_55505 of TGE0019767:
CGTAGGCGCTGTCACGGCTGCCGTCGCCGCCGCCATTTTGACGGCGGAAGAGTCGGGGTCTGGGACTGCCGAAGGCGGTGGTGGTGACTGGAATAACTTTACAAAACGAAAGATATTTTGCGTCTGCCTTCTGCGCTAGAAATGGCCAATGTGCTCTGTAACAGAGCCAGACTGGTTTCCTATCTCCCAGGATTGTACTCTTTAGTTAAAAGGGTTGTCAATCCCAAAGCCTTTTCAACTGCAGGATCTTCAGGTTCTGATGAGCCTCATGTAGCCACTGCACCTCCTGATATATGCTCTCGAACAATATGGCCTGATGAAACTATGGGACCATTTGGACCTCAAGATCAGAGATTCCAGCTTCCTGGGAACATAGGTTTTGATTGTCACCTCAATGGGACCATGTCACAAAAGAAAAGCCAGGTTCATAAAACTTTACCTGATATTCTAGCAGAACCTTTATCAAGTGAAAGACATGAGTTTGTGATGGCACAATATGTGAATGAATTTCAGGGTAATGATGCACCTGTTGAACAAGAAATTAACAGTGCGGAAACTTACTTTGAAAGTGCCAAAGTAGAGTGTGCAATCCAGACATGTCCAGAATTGCTGCGAAGAGATTTTCAGTCACTGTTTCCAGAAGTAACCACCAACAAACTAATGATTCTGACTGTAACACAGAAAACTAAGAATGATATGACTATTTGGAGCGAGGAGGTAGAAAACGAAAGAGAAATGCTCTTAGAAA