Transcript asmbl_55432

Sequence
Transcript Sequence for observation asmbl_55432 of TGE0006507:
AGCCCGGTTGCATTTGTTTAGGGTTGTTGAACTCCTTTTATTTTTTTACTCCTTTTCGTGGGAACCCCGAATAATACTGAGATTTGCTCTAAATTAGAAAACTGGTTTACCAATTATTGCAGAATCCTGCTGTTGGGATTAGCAAGCAGTCTATCATTATGGCTTATTCTGTGCATACTCTTTCCTCAAAATTGCTGAAGGAAAGTTTTTAATTTTAACTGTTGTTGTTTTGCAGATAAAGCTCTGATGGCACCAAATCTTGATTCTTTTGGACGAGATCGGGCACTGTATCAAGAACACGCGAAACGTCGGATTGCAGAACGGGAGGCCAGGAGGACTCGGCGTCGACAAGCCAGAGAGCAAACCGGTAAGATGGCAGATCACCTCGAAGGCCTTTCCAGTGATGATGAAGAAACGTCTACAGATATTACAAATTTCAACCTGGAAAAAGATCGCATTTCAAAAGAGTCCAGCAAGGTTTTTGAAGATGTCCTTGAGAGCTTCTATTCAATTGACTGTATTAAATCTCAATTTGAAGCATGGCGTTCAAAATACTACATGTCCTACAAGGATGCTTACATTGGCCTTTGTTTGCCAAAGTTGTTCAACCCCCTCATAAGGCTGCAGCTTCTCACTTGGACTCCTCTTGAGGCAAAATGTCGTGACTTTGAAAATATGCTGTGGTTTGAATCTTTGCTGTTTTATGGTTGCGAAGAACGAGAGCAAGAAAAAGATGACGTGGATGTCGCACTATTACCTACTATTGTGGAAAAGGTGATTCTTCCAAAACTAACAGTGATAGCTGAAAATATGTGGGATCCTTTTTCTACAACACAGACTTCACGAATGGTTGGAATTACGTTAAAATTAATAAATGGATATCCTTCAGTAGTGAACGCAGAAAACAAAAATACACAGGTGTACCTAAAAGCACTTTTATTGAGAATGCGAAGAACTTTAGATGATGATGTATTCATGCCCTTATATCCCAAAAATGTCTTAGAAAATAAAAATTCTGGGCCTTATTTGTTTTTTCAACGACAGTTTTGGTCTTCAGTTAAGCTATTAGGGAATTTTCTTCAATGGTACGGCATTTTCTCAAATAAAACTCTTCAGGAGTTATCAATAGATGGTTTATTAAATAGATACATTCTCATGGCTTTTCAGAATTCAGAATATGGAGATGACAGCATCAAAAAAGCCCAAAATGTAATCAATTGTTTCCCCAAGCAGTGGTTCATGAACCTGAAAGGAGAAAGAACTATTTCTCAGTTAGAAAACTTCTGTCGGTACCTTGTGCACTTAGCAGATACAATTTACAGAAACAGCATTGGGTGCTCTGATGTGGAAAAAAGAAACGCAAGGGAAAACATAAAACAGATAGTAAAACTCCTTGCAAGTGTTCGAGCTCTGGATCATGCTATGTCTGTTGCAAGTGACCATAATGTGAAAGAATTTAAGTCTTTGATTGAAGGAAAATAGATCTATGAGACTGAAAAGCCTATTTGCTTTAAT