Transcript asmbl_5516

Sequence
Transcript Sequence for observation asmbl_5516 of TGE0006634:
GCAGTTATGCGGTAGGTTCCCAAGATGTCGTTCCCCAAGTACGAGCCGTCGCGCCTGGCCACCTTGCCCTCTACCCTTGACCCAGCTGAGTATGACATATCCCCGGAAACCCGGAAGGCGCAAGCCGAGCGGTTGGCCATAAGATCTCGGCTGAAAAGAGAGTACCTGCTGCAGTACAACAACCCTAGCCGCCGAGAGCTCATTGAAGATCCTGCCTTGACTCGTTGGACCTATGCAAGATCTGCAAATATCTATCCCAATTTCAGACCCACTCCCAAGACCTCACTCTTAGGAGCTGTTTTTGGATTGGGGCCCCTTTTCTTCTGGTATTATGTTTTCAAAACTGACAGAGATAGGAAAGAAAAACTTATTCGGGAAGGAAAATTGGATCGAACATTTAACATCTCATATTAATTCTGGCAATGATGACTATGTGTATTATGTTTAAATAAATCTATTAATCATTAAATAGTTTTTCTTTCTTAATGTTACCTTAATTCAATAAACATTTGC