Transcript asmbl_54583

Sequence
Transcript Sequence for observation asmbl_54583 of TGE0006453:
ACGGGAAGAGATCACCTACGACATGCCTTTCAAGAAAGAAAAGTCTTTTGAAATTGTGATTCTGGTGCTGGAAGACAAATTCCAGGTGGCCGTGAATGGGAAGCACGTCCTGCTCTACGCGCACAGGATGCGCCCGGAGGAAGTGGACACACTGGGCATTTACGGCAAAGTGCACATCCACTCTGTGGGCTTCAGCTTCAGCTCGGATTTAGGAAGTACCCAAGCATCTACTCTGGAACTGACAGAGATAAGTAAAGAAAATGCTTCCCAGTGCTGACAGCGGTTTCTTTTCAGACGCTGCCATTTGTCGCAAGGCTGAACTCTTCCATGGGTCCCGGACGGACTGTCGTCATCAAAGGAGAAGTGAACACAAACGCCAAAGGCTTTAATGTCGATCTACTCTCAGGAAAATCGAAGGATATTGCCCTCCACCTGAACCCACGCCTGAACGTTAAAGCATTTGTGAGAAATTCTTTTCTTCAGGAGGCCTGGGGAGAAGAAGAGAGAAATATTACCTGTTTCCCATTTAGTCCTGGGATGTATTTTGAGATGATAATTTATTGTGATGTTAAAGAATTCAAGGTTGCGATAAACGGCGTGCACAGCCTGGAGTACAAACACCGGTTCCTGGAGCTCACCAGTATCGACACGCTGGAAGTCGACGGAGACATCCACTTACTGGAAGTAAGGAGCTGGTAGCTGACGTGAATTGCCTCAAAAACTGAAATACAAAATGGCTTATGTAACACTGGCTTTGTTAAAATGCATCTCAGTATTATCATGTTTATATGTTAAATGAGCTTATAGCAGTTATACTGGGTGTTCCGTCCTAGTAGGTAGTGTGGCTCTGTGAGGCACAGGCGGAAGAAATTTGAAGCAACAGAAGCGTACAGCCATTGCTGAGGCCTTCCTCGCCCCCTGGCCTCGTCTGGAGCCCACTTCCCACTGAACAAGCACTTACGCGGCGCCTGCTCTCACAGCCTCAACGCGCCAAGCACATCCCTTTGCCAGCACCGTGCTGGGGGCCGGGGTGCACGCACGGTGGTGCCCTGGACTGTGCTCCCCGTTCTCTTGAGCTCAGAATCCTGTGTGCTCTGCCCTGTGCACTGTTTCTTCTGCAGGTATCGCATACTCACCAGGGACTTAGAACTGCTCAGCTGTTAAATCACCTAGAAACTAATTCAAAGACAGTACTCTGGCCCCAGTGGTCACACTCAGCGTCATATCTCATAGCTAAGGGGTCGATTTTGACTCCCATCTGGCACTTTCCTTTAGCATAATAAATATCTAGCCCTACTAGCTGTAAGCATTACCAAGTAGTGAACACTATGAAGTCTGAACACAGCACAAAAATTAAGGCAAAAGAATAATCAAGCAAAACAAAAACGAATGTATTGAAATTAACCTGATCTCATTCGCAAGGCCACTGATTTCCGTATCAGTAAATGGTTATTTTAGAACATGTGAATTTAGGTTGAGTCAAAGGTCTGCACGTGCCTCTACAGAAGGTTTAAGGTGGAAGAGGATTTCCATTAGTACAATGTTTATAGGTGACAAAGCATAGCCAAGGTCTGGTTTAATGGCTGCTTCTGAAAGAGGCACGATCGGAAAGTGAAATGCAGCCACTGAGGGCAGGGAGGAGCGTGCGCACCCGTCCTCCGCACGCGAACCAGCACCGCCTCTGCTCTTCCCAGGGATAGTCCATCACGTTAGCGACCGAGATCAAAACATTATTCTACTTTAAGTGATTAAAATCAAACCTGTATCAGCAAGTTAAATTGTTGCGTTCTGTAATTTTTTCTATTCTTTGAAGCGAGTTGGCAGAAATTCTTTGTGGAATTCTTACAGGTCAGATCTTGTTCAAGGAAAATTCAAAGGCTTGGAGTGGGGAGGTAAAAAGCTAAATCAGCCGAATCATTTTATCATATTAAATTGCTGGGCTAGATTCTGCCAGGACTTAGGAGCATTTTCATAACAGGTTTCGGTTAGATACTATTTGTGTCCGTATACGGAAAATGCTATTACTGATCTTGTTTTTAAAAAGTACTCAGCGTAGGAACTTCTAGCACTTGATTCTTTTCCACTTTGTGTTAACTTATTATGCTGAGTTTGCCAAGCTCAAAAAAGACATGGGTGGGAGGGTGTTTGAGAAAGTTGTAGAGGACAAGAAGGCTCTAGAATCCCCAGAGT