Transcript asmbl_54151

Sequence
Transcript Sequence for observation asmbl_54151 of TGE0006437:
GGTTTGCCTGCAATGAAAGTTCGTTCTCTACAGCTAAAGGACATCCTTTCTGAGCTGCTGTGAATAAATTTGGAATGATACTGTATATTTTCATCTAATGGAGAATTAGCTATACCTTGAAAAAGGATTGCTGCACTGGACAACTTCAGACTATTGCTCACAATGTCATCAAACAGGAGTCAGAATCCCCATGGACTGAAGCAGATTGGCCTTGACCAGATCTGGGACGACCTCAGAGCTGGAATCCAGCAGGTGTACACCAGACAGAGCATGGCGAAATCCAGATACATGGAACTCTACACTCACGTTTATAACTACTGCACGAGTGTTCACCAGTCAAACCAAGCGCGAGGGGCTGGCGTCCCTCCTTCTAAATCAAAAAAGGGGCAGACGCCTGGGGGAGCCCAGTTTGTTGGCTTGGAGTTATATAAACGACTTAAGGAATTTTTGAAGAATTACTTGACAAACCTTCTTAAGGATGGAGAAGATTTGATGGATGAGAGTGTACTGAAGTTCTATACTCAACAGTGGGAAGATTACCGATTTTCAAGCAAAGTGCTGAACGGAATTTGTGCCTACCTCAATAGACACTGGGTTCGCCGTGAATGTGATGAAGGACGGAAAGGAATATATGAAATCTATTCTCTCGCGTTGGTGACTTGGAGAGATTGTCTGTTCAGGCCATTGAATAAACAGGTAACAAATGCTGTTTTAAAACTGATTGAAAAGGAAAGAAATGGTGAAACCATCAATACAAGACTGATTAGTGGAGTCGTACAGTCTTACGTGGAATTGGGGCTAAATGAAGATGATGCGTTTGCAAAGGGCCCTACGTTAACAGTGTATAAAGAATCCTTCGAGTCTCAGTTTCTGGCTGACACAGAGAGATTTTATACCAGAGAGAGCACCGAATTCTTGCAGCAGAACCCGGTTACTGAATATATGAAAAAGGCAGAGGCCCGTCTGCTCGAGGAGCAGCGGAGAGTGCAGGTTTACCTTCACGAGAGCACCCAGGACGAGCTCGCACGGAAGTGTGAGCAAGTGCTCATTGAGAAGCACCTGGAAATTTTCCACACAGAGTTTCAGAACCTGTTGGATGCTGACAAAAATGAAGATCTGGGTCGCATGTATAATCTTGTGTCTAGAATCCAGGATGGCCTAGGAGAATTGAAGAAACTTTTGGAGACGCACATTCATAATCAGGGTCTTGCAGCAATTGAAAAGTGTGGAGAAGCTGCTTTAAATGACCCCAAAATGTATGTACAGACAGTGTTGGACGTTCATAAAAAGTACAACGCCCTGGTCATGTCCGCGTTCAACAACGATGCGGGCTTTGTGGCCGCACTGGACAAGGCTTGCGGTCGCTTCATAAACAACAACGCAGTTACCAAAATGGCACAGTCGTCCAGTAAATCCCCTGAGCTGCTGGCCCGATACTGCGACTCCTTGTTGAAGAAGAGCTCCAAGAACCCAGAAGAAGCAGAACTAGAAGATACGCTCAATCAAGTGATGGTTGTCTTCAAGTACATAGAGGATAAAGACGTGTTTCAGAAGTTCTACGCAAAAATGCTGGCCAAAAGACTGGTGCATCAGAACAGTGCAAGTGATGATGCCGAAGCAAGCATGATCTCTAAACTAAAGCAAGCCTGTGGCTTCGAGTACACCTCTAAGCTGCAGCGGATGTTCCAGGACATCGGCGTGAGCAAAGACCTGAACGAGCAGTTCAAAAAGCACCTGACGAATTCAGAGCCGCTAGACTTGGATTTCAGTATTCAGGTTCTGAGTTCCGGATCGTGGCCCTTTCAGCAATCCTGTACATTTGCCCTGCCGTCGGAGCTGGAACGTAGTTATCAGCGCTTCACAGCTTTTTATGCTAGCCGTCACAGTGGCCGAAAGTTGACATGGTTATATCAGCTGTCTAAAGGAGAATTGGTAACAAACTGCTTCAAAAACAGATACACTTTGCAGGCATCCACGTTCCAGATGGCGATCCTGCTGCAGTACAACACAGAAGACGCGTACGCCGTGCAGCAGTTGGCGGACAGCACTCAGATCAAAATGGACATTTTGGCACAAGTCCTACAGATTTTATTGAAGTCGAAGTTATTGGTCTTGGAAGATGAAAATGCAAACGTCGATGAGGTGGAACTGAAGCCAGACACCTTGATAAAATTGTATCTTGGTTATAAAAATAAGAAATTAAGGGTTAACATCAATGTGCCAATGAAAACTGAACAGAAGCAGGAACAAGAAACCACACATAAAAATATTGAGGAAGATCGCAAACTCCTGATTCAGGCAGCTATTGTGAGAATTATGAAAATGAGGAAAGTTCTGAAACACCAGCAGTTACTTGGAGAAGTGCTCACGCAGCTGTCCTCGCGGTTCAAGCCTCGGGTCCCAGTAATTAAGAAATGCATTGACATTCTGATCGAGAAAGAATATTTGGAGCGAGTGGATGGTGAAAAGGACACCTACAGTTACTTGGCTTAACCCTTCCAGAAGTG