Transcript asmbl_54090

Sequence
Transcript Sequence for observation asmbl_54090 of TGE0019711:
GCCGCCGCTCTGCTGCAGCCGCAGCTGCAGCTCTGCAGAGCAAGGCTGGGGGCTGGGGCCGGGGCGCCCTCCCTCCCACCTTTTCCCGCCGCTATGAGCCAGGGAAGTTCGGGGGACTGGGCCCCACTCGAGCCCACCTCCGGACCCCCAGCGCCCCCCAATCCCTTCGTACATGAGTTACGTCTCTCCCGCCTCCAGAGGGTTAAGTTCTGCCTCCTGGGGGCACTGCTGGCCCCCATCCGAGTGCTTCTGGCCTTTATCGTCCTCTTTCTCCTCTGGCCCTTTGCCTGGCTGCAAGTAGCTGGTCTTACTGAGGAGCAGCTTCAGGAGCCACTTACGGGATGGAGAAAGACCGTGTGCCACAATGGGGTGCTGGGCCTCAGCCGCGTGCTCTTTTTCCTGCTGGGCTTCCTCCGGATTCGTGTTCGAGGCCAGCGCGCCTCTCGCCTTCAAGCCCCTGTCCTTGTTGCGGCCCCCCACTCTACTTTCTTTGACCCCATTGTTCTGCTTCCCTGTGACCTGCCCAAGGTCGTGTCCCGAGCTGAGAACCTTTCTGTGCCTGTCATTGGAGCCCTTCTTCGCTTCAACCAAGCCATCCTCGTATCCCGCCATGACCCAGCTTCTCGGCGCAGAGTGGTGGAGGAGGTCCGAAGGCGGGCTACCTCAGGAGGCAAGTGGCCCCAGGTACTGTTCTTTCCTGAAGGCACCTGTTCCAACAAGAAGGCTTTGCTTAAATTCAAACCAGGAGCCTTCATCGCAGGAGTCCCTGTGCAGCCTGTCCTCATCCGCTACCCCAACAGTCTGGACACCACCAGCTGGGCATGGAGGGGCCCTGGAGTACTCAAAGTCCTCTGGCTCACAGCCTCTCAGCCCTGCAGCATTGTGGATGTGGAGTTCCTCCCTGTGTACCACCCCAGCCCAGAAGAGAGCAGGGACCCCACCCTGTATGCCAACAATGTCCAGAGGGTTATGGCACAGGCCCTGGGCATTCCAGCCACTGAGTGTGAGTTTGTAGGGAGCTTGCCTGTGATTGTGGTGGGTCGGCTAAAGGTAGCATTGGAGCCACAGCTCTGGGAACTGGGAAAAGTACTTCGCAATGCTGGGCTGTCCCCTGGCTATGTGGACGCTGGGGCAGAGCCAGCCCGGAACCGAATGATCAGCCAGGAAGAGTTTGCCAGGCAGCTGCAGCTCTCTGACCCACAGACCGTAGCTGGTGCCTTTAACTACTTCCAGAAGGATGCCAGCGGTTTGGTGGACTTCCGAGATGTGGCCCTTGCACTGGCAGCTCTGGATGGGAGCAGGGACCTTGAGGAGCTGACTCTCCTGGCCTTTGAGCTCTTCGCCGAGGAGCAAGCAGAGGGACCTGGCCGCCTGCTGTATAGAGACGGCTTCAGCACCATCCTGCACCTGCTGCTTGGGTCACCCCGCCCAGCTGCTGCGACTTTGCATGCTGAGCTGTGCCAGGCGGGATCCGACCAAGGCCTCTCCCTCTGTCAGTTCCAGGACTTCTCCCTCCGTGACCCACTCCACGGGAAGCTCTTCAGCACCTACCTGCGCCCCTCCCAGACACCAAATGCCTCATCCCCAGGCAGCCCCACTGCTCTGGCCAATGGGACTGTGCACGTGCCCAAGCAGAAGGGCGACTGAGCGCCTCCACCTCCCCAGCTCGCATCCAGCCCACAGACTCAGGGCAGCGCCAGGGGCTGACCCTGGGCCTCACGCCCTCTCTGCTCCTGCTTGATTTTTTGTTATTGTTGTTTGTTTTATTAAGTTTGTTTTATTAAGTTGATTTTCACTTTTTGTTTGATTTTTTGTAAGAAAC