Transcript asmbl_53959

Sequence
Transcript Sequence for observation asmbl_53959 of TGE0006402:
TACCTCGGAAGCCTTACTTCGCCAGTTGAAACTGCAGAAGAAAATAGGATCTAGCGAAATATGGCTACGGAGGGCCCTGCCACGTGTCGAATCCAGGTGGCAGAACATCCCAGATTGCTAAAGCTAAAAGAGACATTTAACTCTAAGTTTGGATCCATTCCCAAGTTTTATGTTCGAGCACCAGGAAGAGTCAACATAATAGGAGAACATATAGATTACTGTGGATATTCTGTTCTTCCTATGGCTGTGGAACAAGATATGTTAATAGCTGTGGAACCTGTGAAAACACACACTCTTCAACTGGCCAATACAAATCCCTTGTACCCAGATTTCAGTACTAGTGCTAATAACATTCAGATTGACAAAACCAAGCCTCTGTGGCACAACTATTTCCTATGTGGATTTAAAGGAATTCAGGAACACTTTGGTCTTAGTAACCTGACTGGAATGAATTGCTTGGTGGATGGAACCATCCCACCAAGTTCTGGCCTCTCCAGCTCCAGTGCTTTGGTCTGTTGTGCTGGCTTGGTGACGCTCACAGTTTTGGGAATGAACCTATCCAAGGTGGAACTTGCAGAAATCTGCGCCAAGAGTGAGCGTTATATTGGCACCGAAGGAGGAGGGATGGACCAGTCCATATCATTTCTTGCAGAAGAAGGAACGGCCAAGTTGATAGAATTTAGTCCTCTGAGGGCAACGGATGTGAAACTCCCAAGTGAAGCAGTGTTTGTGATTGCCAACAGTTGTGTGGAAATGAATAAGGCAGCAACTTCCCATTTCAACATCAGGGTGATGGAGTGCCGGCTGGCTGCAAAGCTCCTGGCTAAGTACAAAAGCTTGCAATGGGATAAAGTACTGCGGCTGGAGGAGGTACAGGCCAAACTAGGGGTCAGCCTGGAAGAAATGCTGTTAATCACAGAGGATGCTCTTCACCCTGAACCCTATAGCCCCGAAGAGGTCTGCAAGTGTCTGGGAATTAGCCTGCAGGAACTCCGGACCCAAATCCTGAGTCCGAACACACAAGATGTGCTCATCTTCAAACTCTACCAGCGGGCAAAGCACGTGTACAGTGAGGCTGCGCGAGTACTCCAATTTAAGAGGATATGTGAAGAGGCACCTGGCAACATGGTCCAGCTGCTGGGGGAGCTAATGAACCAGAGCCATGTGAGCTGCCGGGACATGTACGAGTGTAGCTGCCCTGAGCTGGACCAGCTG