Transcript asmbl_53855

Sequence
Transcript Sequence for observation asmbl_53855 of TGE0006378:
CTGGGCTCGCAGCCGTGCGGCGGGGCTTGACGGAGCAAAGCGTCTCAGCCGTAGCTTCCAGTTTCGTGCGGCTCGTTTCTGCGACCCGCTGTCCTCGCCAGCCCTTCCAGCGAGCTTGGCGTCCCGCGCGCGCGTCTAGGCATCACGGAGCCTGCTGCCATGAAGCCAGCGAGGACTAAGACACCCAGGAAACCTGTAGTGAAAAAAGGATCCCAAACAAGTCTTAAAGACCCAGTTGGGGTATACTGTAGGGTGCGCCCACTGAGCTTTCCTGATCACGAGTGTTGCATAGAAGTGATCAATAATACAACTGTTCAGCTTCATACTCCTGAGGGTTACAGACTCAACCGAAATGGAGACTATAAGGAGACTCAGTATTCATTTAAACAAGTATTTGGCACTCATACTACCCAGAAGGAGCTCTTCGATGTTGTGGCTAATCCCTTGGTAGATGACCTTATTCATGGCAAGAATGGTCTCCTTTTTACATATGGTGTGACGGGAAGTGGGAAAACTCACACCATGACTGGTTCTCCAGGGGAAGGAGGGCTACTTCCTCGTTGTTTGGGCATGATCTTTAACAGTATCGGGTCATTTCAAGCTAAACGATATGTTTTTAAGTGTAATGATAGGAATAGCATGGATATACAGTGTGAAGTTGATGCCTTATTAGAACGGCAGAAAAGAGAAGCCATGCCGCATCCAAAGACCCCTGCTATCAAACGACAAGCAGACCCAGAGTTTGCAGATATGATAAATTTACAAGAATTTTGCAAAGCAGAAGAGGTTGATGAAGATAGTGTCTATGGTGTATTTGTCTCTTATATTGAAATATATAATAATTACATATATGATCTATTGGAAGAAGTTTCGTTTGATCCCATAAAGCCAAAGTGGAACAGTTGCAGCACGCCCATGAGGAACACAGACTTTGTACCTCCGCAATCTAAATTGCTTCGTGAAGATAAGAACCATAACATGTATGTTGCAGGATGTACAGAAGTAGAAGTAAAATCTGTTGAGGAGGCTTTTGAAGTTTTCTGGAGAGGCCAGAAAAAGAGACGTATTGCTAACACACATTTGAATCGTGAGTCTAGCCGTTCTCATAGCGTGTTCAACATTAAATTAGTTCAAGCTCCACTGGATGCAGATGGGGATAATGTCTTACAGGAAAAAGAACAAATCACTATAAGCCAATTGTCCTTGGTAGATCTTGCTGGAAGTGAAAGAACTAACCGGACAAAAGCAGAAGGGAACAGATTACGTGAAGCTGGTAACATTAACCAGTCACTAATGACACTAAGAACATGTATGGAAGTCCTGAGAGAGAACCAAATGTATGGAACTAACAAGATGGTTCCATATCGCGATTCAAAGTTAACTCATCTATTTAAGAACTACTTTGATGGAGAAGGAAAAGTACGCATGATTGTGTGTGTGAATCCAAAGGCCGAAGATTATGAAGAAAGCTTGCAAGTCATGAGATTTGCGGAAGTGACCCAAGAAGTTGAAGTAGCAAGACCTGTAGACAAGGCAATATGTGGTTTAACGCCTGGACGGCGATTCAGGAATCATGCTCGGGCAGGTCCAGTTGAACTACTGGTTACAGAAGTGGTTTTACAGAGTTTTCCACCTTTGCCATCCTGTGAAATTTTGGATATCAATGATGAGCAGACTCTCCCGAGGCTGATTGAAGCTTTAGAGAAACGCCATCAACTACGACAAATGATGACTGATGAGTTTAACAAACAATCTGTTACTTTTAAAGCTATGTTGCAAGAATTTGACAATGGTGTTTTAAATAAAGAAAACTACATTCAAGGAAAACTAAATGAAAAAGAAAAGGTGATCTCAGGACAGAAATTGGAAATAGAACGACTGGAGAAGAAAAACAAAACTTTAGAATATAAGATTGAAATTTTAGAGAAAACAACTACTATCTATGAAGAAGATAAGCGCAATCTGCAGCAGGAACTTGAAACCCAGAATCAGAAACTTCAGCGACAGTTTTCTGACAAACGCAGACTAGAAGCCAGGTTACAAGGCATGGTGACAGAAACAACAATGAAATGGGAGAAAGAATGCGAGCGTCGAGTGGCAGCTAAACAGCTGGAGATGCAAAATAAACTCTGGGTGAAAGATGAAAAACTGAAACAACTAAAGGCTATTGTTACTGAACCCAAAACTGAAAAGCCAGAGAGACCCTCTCGGGCACGAGATCAAGAAAAAGCTCCTCAAAGATCTGTTTCTCCATCGCCAGTACCCCTTTCTAGTAACTATATTGCTCAGATTTCCAACGGCCAGCAACTCATGAGCCAGCCACAACTACATAGGCGCTCTAACTCTTGCAGCAGCATTTCTGTAGCTTCCTGTATTTCGGAGTGGGAGCAGAAAATTCCTCCGTACAACACACCTCTCAATGTCACATCCATTGCAAGGCGTAGGCAGCAGGAGCCAGGACAAAGTAAAACTTGTATCGTGTCAGACAGAAGGCGAGGGATGTACTGGACTGAAGGCAGGGAGGTGGTTCCTACATTCAGAAATGAGATAGAAATAGAAGAGGATCATTGCTGCAGGAATGTACCACCACTTCGTCTCCGACACAGACGATCACGCTCTGCAGGAGACAGATGGGTAGATCATAAGCCTGCCTCTAACGTGCAAACTGAAACAGTCATGCAGCCACATGTCCCTCATGCCATCACAGTATCTGTTGCAAATGAAAAGGCACTAGCTAAGTGTGAGAAGTACATGCTGACCCACCAGGAACTAGCCTCCGATGGGGAGATTGAAACTAAACTAATTAAGGGTGACGTTTATAAAACAAGGGGTGGTGGACAATCTGTTCAGTTTACTGATATTGAGACTTTGAAGCAAGAATCACCAACTGGTCGAAAACGGAGATCTTCCACAGTAACACCTGCCCAACCAGATGGTGCAGAGTCTGAATGGACCGATGTAGAAACAAGGTGTTCTGTGGCTGTAGAGATGAGAGCAGGGTCTCAACTGGGTCCTGGATATCAGCATCACGCACAACCCAAGCGCAAGAAGCCATGAACTGACAGTCTAATTAATGAAAGAACATTTTGTGTCAGTAATTTCTTCAAGACCATGCCAGAAGGAGTCTTCTGAGTCATCTTGTAGAAGTCCAACTTTGACTATCACAGACCTCAGATACATCATACACTGGCCTAGATCAGAGATTTCTGTCTGGTTCCAAAGACATCTAGGATTCAACAAACTTTTTATATCCCTTGCCATATTTAATATTAATAGAGAAAGACCCCCCTTTTCTCATTGCTGCATGAACTTTTTAATAATGCTATTTTTGTATATTTGTATACTTATAAACTAATTCATGCAAGTGTTTGTCTTGGGTGATTAAGGAAGAATATATCTAGATCACGCTTTATTTTTTATTGTGACTTTTCCAGCTCTTGTCTGAATATTAAGGTTTTATAAACAAAACAAATGCTGCTATTGATTAGCTGCAAGAATGCACTTTAGACATATTTGACAATTCAAACTTTCAAAATAAAGATGTCAATGACTGGCCAATACTAAAACCATTTTAAGAAGTCGTTTTGAATTTTGTATGTATATATTCACTTTCTGACACTTAGATATACCAAAAGAATTGAAATAAAAAGCACTAAGAAATACAAA