Transcript asmbl_5385

Sequence
Transcript Sequence for observation asmbl_5385 of TGE0006556:
CGTAGACCCGCCCCCCACCCCCTCTGCAGCTGAAGGCTTCCCCTCCGTCAGTGACAGAGCCTTCGGGTGCGTGATCACTTGTGGTTCTGCACCTCGCGCGTTGGCAGGTAAATTAACATGATGGATTTCTCCAAGCTACCCAAAATACTCGATGAAGATAAAGAAAGCACATTTGGTTATGTGCATGGGGTCTCAGGACCTGTCGTTACCGCCTGTGACATGGCAGGTGCAGCTATGTATGAGCTGGTGAGAGTGGGCCACAGCGAGTTAGTTGGAGAGATTATCCGATTGGAGGGGGATATGGCTACTATCCAAGTGTATGAAGAAACCTCTGGTGTGTCTGTCGGAGATCCTGTACTCCGCACTGGTAAACCCCTTTCAGTAGAGCTTGGTCCTGGCATTATGGGAGCCATTTTTGATGGTATTCAAAGACCTTTGTCCGATATCAGCAGTCAGACTCAAAGTATCTACATTCCCCGAGGAGTAAATGTGTCTGCTCTTAGCAGAGATATCAAATGGGATTTTACACCCTGCAAAAATCTACGGGTTGGTAGTCACATCACTGGTGGAGATATTTATGGAATTGTCAATGAGAATTCTCTCATCAGACACAAAATCATGTTACCCCCACGAAACAGAGGAACCGTAACTTATATTGCTCCACCTGGAAATTACGATACCTCTGATGTTGTCTTGGAACTTGAATTTGAAGGTATAAAGGAGAAGTTCAGCATGGTCCAAATATGGCCTGTACGTCAAGTTCGGCCTGTCACTGAGAAGCTGCCGGCTAATCATCCTTTGTTGACTGGCCAGAGAGTCCTCGATGCCCTTTTTCCATGTGTACAGGGAGGAACTACTGCAATCCCTGGGGCTTTTGGATGTGGAAAGACGGTGATATCACAGTCTCTATCCAAGTATTCCAATAGTGATGTAATCATCTATGTAGGATGTGGTGAAAGAGGAAATGAGATGTCTGAAGTCCTTCGTGATTTCCCAGAGCTCACTATGGAAGTTGATGGTAAGGTAGAGTCAATTATGAAGAGGACAGCTTTGGTAGCCAATACCTCCAACATGCCTGTGGCTGCCAGAGAAGCCTCCATTTATACTGGAATTACACTGTCAGAATATTTCCGTGACATGGGCTATAATGTTAGTATGATGGCTGACTCAACCTCTAGATGGGCTGAGGCCCTGAGAGAAATCTCTGGTCGCTTAGCTGAAATGCCTGCAGATAGTGGATATCCTGCATATCTTGGTGCCCGTCTGGCCTCTTTCTATGAGCGAGCAGGCAGGGTGAAATGTCTTGGAAATCCTGAAAGAGAAGGGAGTGTCAGCATTGTAGGAGCAGTTTCTCCACCTGGTGGTGATTTTTCTGACCCAGTTACATCTGCTACTCTTGGTATTGTTCAGGTATTCTGGGGCTTAGATAAGAAACTAGCCCAACGTAAGCATTTCCCCTCTGTTAATTGGCTAATCAGCTACAGCAAGTATATGCGTGCCTTGGATGAGTACTATGACAAACACTTCACAGAATTTGTTCCTCTGAGGACCAAGGCTAAGGAGATTCTGCAGGAAGAGGAAGACCTGGCAGAAATTGTGCAGCTTGTGGGAAAGGCTTCTCTAGCAGAAACAGATAAAATCACTCTGGAGGTAGCCAAACTTATCAAAGATGATTTCCTACAACAAAATGGATATACTCCTTATGACAGGTTCTGCCCATTCTACAAGACAGTAGGGATGCTGTCCAACATGATTGCATTTTATGATATGGCCCGTAGAGCTGTTGAAACCACTGCCCAGAGTGACAATAAAATCACATGGGCCATTATCCGTGAGCACATGGGGGAGATCCTCTATAAACTTTCCTCCATGAAATTCAAGGATCCATTGAAAGATGGTGAGGCAAAGATCAAAGCAGACTATGCACAACTTCTTGAAGATATGCAGAATGCATTCCGTAGCCTTGAAGATTAGAACTGTGATTTCTTTCTTCCTTTTCCTCAGCAAGTTCTCATGTGTGTATATTTTCCTAGATCTCATCTCAGACCCTTTGCTTTTTTATTGTGCAGCTTTGAGATTCGTGCCTATATGTGTTATCATTTCTTTTCCGGTTTATTTGGTAGGTCTTATATAAAGCAAACATTCCTTTGTTCCAGTGTTTGAAGGGCCTCCTTGATCCTTTCTCCAAAGTGGTGAATGTAGTAAATATGATATACTCTGGCTACACTACTGTAAACTTGTGTGTAGAGTCATGTCCCTCCTTGTCCTAGGTTTGCCCTTTCCTTATCGCCATTACATTGTAAACAGGACTACTGCATGTACTTTGCAACAGATTTGGAATGAAAGGCCAGATTTCTATACATTTTGCCAGGTACTTTATAAAGTGACTTGATATCTATCTACATGTCAAGGTTATTTGCAGTTTAGCATTTTACTAAGTAACTGCTTTGCAGGAAATGTTTGCTTTTTTAAAAAAGATGAATGATTAACGTTCCAATTATGCATTGCTTCCCCACTATATATCAGGAATATTTATGGGAAACTGTTGGGGACTATACTGTTTTTAAAAGTCTTTTGTGGGGACTCAGCACAATATATGAATCAGTACCCTCTAAAAAAGTAAAAAAAAGGGGTCAGATGGTCAAATTTAGATTAATGTCATCTTGTTAAACCTTATTTTGTTTCACTAGGAAAATTTCAGTATCAAGGAATAGTCTACCGCATTACTAGGAAATTCTCTTTTAAATTACATTTAGAACAATCACTGAAAACTTAATCCACATCATATCCTTTTCCTTAAACATCTTAGAAGCTTAAGCTTCTAAGAATCATGTGGCAGCGTGATGGGCAATAAAATGTCACAAAGAAGATATTTATTAATGGTTAAAGGCTCTTTGCACCTTTAAGGACCAGCTGAGCTGTACTGATTCTTGGGGCCAGAGTGGCATTATGTTTTTACAAAATGACATGTGTCACATGTTTGCATGTTTGTTCACTTATTGAATTTTTGAACAAGCAGTTTACCAATTGTAGACGTAATATTTTCTTTCATGTGGGTTTTGATTCACTGGCTCAAGAGTTCTCAGAATATCTGTAGCCATAGCAGCTTACCAGTTTCCATTTGGTTTAATAGGGATAAATTAATTTTTGTGTCTGCTGATGGCAGAATCTAGGTCATGTGAAGAAAGATTATTTCGTCCTATCTTTGAAGTATATATTTTAAAATAGTAGTTTCAGTGTTTGTACAATAAGGTACACTGCAGAACAGCTTTGAGAGCAACAGTTTCCCATTAACTTTTTCTGACCCATAGTGCTGGCATCATCGCTTCCTCTTTGGGAAGAGGAAGGGTGTTGAACATATCTAACAATCTCAAATACCTAAATATAATAGCATAAATAAAGTATTTATTTTATGCTTCAGTATGTTATTATTTAAATTTTTAGGTAATGTATTTCTTTTGGTCTGTTAAGGAAAGATGCAGTCAGAGAATTCAGCTGTAGGTTTTTTTAAATCCTTGCAGGTTGATGCTCTTACTGTGGACTACTATTCAGGACAGAGGTTCTTCCATACAACTTTTTGTAACCTTTCAGAGCACTGGAAGATAAAAATTTTACAATGATCTCTTGAGATGTGAATTTAATGGTGCTGCTTAATCAGTTTGCTTTCAGTGTGGCCTCCTGCCCAGAGATCTTAAGACCAGTGGAAATTAAAAGGATTTAAAAACTTTCTATTTCTACCTTAAACTTACCAGCACACTAGGTGGTGATGAATGATATGACAAAGAAAGCTTGACCAAGTTTGTTTTTTTGTCGTTCCAAATTTGCAGTGTACACTCTTACTCTTTTTTAAGAATGTTGATATATGGGTGTGGAGATGCTAGAGAAACTATGCTCAGATATTCAGTAGAAGTGTTCCTTCAGCTATGTTAAGAATTTCATATTGGTCACTGATCATATTTCTTTAGTAAGAATGTGTTAAAATTACCACAGTCTTTTAAAAAGATGATGCAGTTCTATATTTATTGTGCTGTGCCTGGTCCTAAGTGGAGCCAGTTAAACAAGTTTCATATGTATTTTTCCAGTGTTAAGTGTCACACATTGTACCCTTTGGAAATTTCCTGCCATCCCAAGGAATGAATAGAAGAGACCATATATATTGCCTCCATATCCTTGAGATTTCATTATCTTTATGTTAACAGTTGTGTATAATTGTTAAAATCTATGAAAGAATAAAAAGTGGATTTAAATT