Transcript asmbl_53840

Sequence
Transcript Sequence for observation asmbl_53840 of TGE0006434:
GCCTGGCCGCCCTCTCGCCGCGTCGCCGGTCCCTGAGCCGCCCGCACCTCCTCGCCTCTCCTCTCCCGGCCGAAGCCCGGGGGACCAGAGCGAGAAGCGGGGACTATGTTCCGACGCAAGCTGACGGCCCTCGACTACCACAACCCTGCCGGCTTCAACTATAAAGATGAAACAGAATTTAGAAACTTTATTGTTTGGCTTGAAGACCAGAAAATCAGACACTACAAGATTGAAGACAGAGGTAATTTAAGAAACATCCACAGCAGTGACTGGCCCAAGTTCTTTGAAAAGTATCTCAGAGATGTTAATTGTCCTTTCAAGATTCAAGATCGACAAGAAGCAATTGACTGGCTTCTTGGTTTAGCTGTTAGACTTGAATATGGAGATAATGCTGAAAAATATAAGGACTTGGTACCTGATAATACTAAAAATGCTGACAAAGCAGCTAAAAATGCAGAGCCACTGATCAATTTGGATGTAAATAATCCTGATTTTAAGGCTGGTGTCATGGCTTTGGCTAACCTTCTTCAGATTCAGCGTCATGATGATTACCTGGTGATGCTTAAGGCAATTCGCATTTTGGTCCAGGAGCGCCTGACACAGGATGCAGTTGCTAAAGCAAATCAAACAAAAGAGGGCTTGCCTGTTGCTTTAGACAAGCATATTCTTGGTTTTGACACAGGAGATGCAGTTCTTAATGAAGCTGCTCAAATTCTGCGATTGCTGCACATAGAAGAGCTCAGAGAGCTACAGACAAAAATTAATGAAGCCATAGTAGCTGTTCAGGCAATTATTGCTGATCCAAAGACAGACCACAGACTGGGGAAAGTTGGAAGATGAACATTTTAGGATGTTAGCCGCTCACCTACTTAGTACAGTTGGGAACCATGTATGCTGTGGCATGTGTTTGGGAATCAAATGTCAATTTTCAAGGAAAGGATCCCAGAAAATTGACTATGTTCTAGAGATTTATCATCATTGCTTTTTCTTTAATAAAGTTCAGGAATGTA