Transcript asmbl_53824

Sequence
Transcript Sequence for observation asmbl_53824 of TGE0019686:
CCTGTCCCAGTTACTAAACAGCCTACCCCGCCGTCAGAAGCAGCTGCCTCAAAGAAGAAACCAGGGCAGAAGAAGTCTAAAAATGGAAACGATGATCAGGATAAAAAGGTGGAAACTCTTATGGCACCTTCAAGAAAGCAAGAATCATTACCCCTCCACCAAGAGACTAAACAAGAAAGTGGATCAGGAAAGAAGAAAGTTTCATCAAAGAAGCAAAAGACAGAAAATGTCTTGGTAGACGAACCCCTTATTCATGCAACTACTTACATTCCTTTGATGGATAATGCTGACTCAAATCCCGTGGTGGATAAGAGAGAGGTTATTGATCTAATTAAATCTGACCAAGTAGAAGCAATTCAGAAAACAGGGGCTAAAAAACTGAAGACTGAAACTGACAAAGAAAATGCTGAGGTGAAATTTAAAGATTTTCTTCTGTCCTTGAAGACTATGATGTTTTCTGAAGATGAGGCCCTTTGTGTTGTAGACCTGCTAAAAGAGAAGTCTGGTGTGATACAGGATGCTTTAAAGAAGTCAAGTAAAGGAGAATTGACTGCACTTTTACATCAGCTTCAAGAAAAAGACAAATTACTTGCTGCTCTGAAGGAAGACGGCACTGCTATGAAGGATCGGTGTAAGCAGCTAACCCAGGAAATGATGACAGAGAAAGAAAGAAGCAATGTGGTTATAGCAAGGATGAAAGATCGGATTGGTGCATTAGAAAAGGAACATAATGTATTTCAAAACAAAATTCATGTCAGTTATCAAGAGACTCAACAGATGCAGATGAAGTTCCAGCAAGTTCGTGAGCAGATGGAGGCAGAGATAGCTCACTTGAAGCAAGAAAATGGCATACTGAGAGATGCTGTCAGCAACACTACAAACCAACTAGAAAACAAGCAGTCTGCTGAACTAAATAAACTGCGCCAGGATTATGCCAGATTGGTGAATGAGCTGACTGAGAAAACAGGAAAGCTACAGCAAGAGGAAGTCCAAAAGAAGAATGCTGAGCAAGCAGTTACTCAGTTGAAGGTTCAACTACAAGAAGCTGAGAGAAGGTGGGAAGAAGTCCAGAGCTATATCAGGAAGAGGACAGCAGAGCATGAGGCAGCACAGCAAGATTTACAGAGTAAATTTGTGGCCAAAGAAAATGAAGTACAGAGTCTGCATAGTAAGCTTACAGATACCTTGGTATCAAAACAACAGTTGGAACAAAGACTAATGCAGTTAATGGAATCGGAGCAAAAAAGGGTGAACAAAGAAGAGTCTCTACAAATGCAACTTCAGGATATTTTGGAGCAGAATGAGGCTTTGAAAGCTCAAATTCAGCAATTCCATTCCCAGATTGCAGCTCAGACCTCTGCTTCAGTTCTAGCAGAAGAATTACATAAAGTGATTGCAGAAAAGGATAAGCAGATAAAACAGACTGAAGATTCTTTAGCAAATGAACATGATCATTTAACAAGTAAAGAGGAGGAACTTAAGGATATACAGAATATGAATTTCTTATTAAAAGCTGAAGTGCAAAAATTACAGGCCCTGGCAAATGAACAGGCTGCTGCTGTACATGAACTGGAGAAGATGCAAAAAAGTATTCATGTTAAGGATGATAAAATAAGATTGCTTGAAGAGCAGCTACAGTGTGAAATTTCAGACAAAATGGAAGAATTTAAGATTCTAAATGACCAAAACAAAGCATTACAATTAGAAGTTCAGAAGCTACAGACTCTTATTTCTGAACAGCCTAATAAAGATGTTGTGGAACAAATGGAAAAATGCATTCAAGAAAAAGATGAGAAGTTGAAGACTGTGGAAGAATTGCTTGAAACTGGGCTTATTCAGGTGGCCACTAAAGAAGAAGAACTGAATGCAATAAGAACAGAAAATTCATCTCTGACGAAAGAAGTTCAAGACTTAAAGGCTAAGCAGAATGATCAGGTTTCTTTTGCATCTCTAGTTGAAGAACTTAAGAAAGTGATCCATGAAAAAGATGGAAAGATCAAGTCTGTGGAAGAGCTTCTGGAAGCTGAACTTCTCAAAGTTGCTAATAAGGAGAAGACTATTCAGGATTTGAAACAGGAAATAGAGGCTCTAAAAGAAGAAATAGGAAATATCCAGCTTGAAAAGGCTCAACAGTTATCTATCACTTCTCAAGTTCAGGAGCTTCAGAACTTGTTAAAAGGAAAGGAGGAACAGATAAATACCATGAAGACTGCTTTAGAAGAGAAGGAGAAAGATCTAACTAATAGAGGGAAATGGTTACAGGATCTTCAAGAAGAAAATGAATCTTTAAAAGATCATGTTCAGGAGATAGCACAACATAACTTGAAAGAGGCATGTTCTGCATCACGATTTGAAGAACTTGAGACTGTGTTGAAAGAAAAGGAAAATGAAATGAAGAGAGTAGAAACTATGCTGAAGGAGAGGGAGAGTGATCTTTCTAGCAAAACAAAGCAGTTACAGGAGGTACAAGATGAAAACAGATTGTTTAAATCCCAAATCGAGCAGCTTAAGCAACAGAACTACCAACAGGCATCTTCTTTTTCCCCTCATGAAGAACTATTGAAAGTAATTTCAGAAAGAGAGAAGGAAATAACTTGTCTCCAGAATGAGTTAGATTCTTTGAAGGATGCGGTTGAACACCAGAGGAAGAAAAATAATGAAAGACAACAACATGTGGAAACTGTTGAGTTGGAGGCTAAGGAAGTTCTCAAAAAATTATTTCCAAAGGTGTCTGTCCCTTCTAATTTGAGTTACAGCGAATGGTTACGTGGATTTGAAAAGAAGGCAAAAGAATGTGTGACTGAAACTTCAGGTTCAGAGGAGGTTAAGGTTCTAGAGCACAAATTAAAAGAAGCTGATGAAATGCACACATTGTTACAGCTGGAGTGTGAAAAATATAAGTCCGTCCTTGCAGAAACAGAAGGAATTTTACAGAAGCTACAGAGAAGTGTGGAACAAGAAGAAAATAAATGGAAAGTTAAGGTCGATGAATCACAAAAGACTATTAAACAGATGCAGTTGTCATTCACATCTTCGGAACAAGAGCTAGAGCGATTAAGAAAAGAAAATAAAGATATTGAAAATTTGAGACGAGAACGAGAGCATTTGGAAATGGAACTAGAGAAGGCAGAAATTGAACGATCTACCTATGTCACAGAAGTCAGAGA