Transcript asmbl_53822

Sequence
Transcript Sequence for observation asmbl_53822 of TGE0006374:
GGTTTTATAGGATCACATTAACAAAAACATGATGGAGTTTTATGAGTCAACATATTTTATTGTCCTTATTCCTTCAGTAGTGATTACAGTAATTTTCCTCTTCTTCTGGCTTTTCATGAAAGAAACATTATATGATGAGGTTCTTGCAAAACAGAAAAGAGAACAAAAGCTTATTCCTACCAAAACAGATAAAAAGAAGGCAGAAAAGAAAAAGAATAAAAAGAAAGAAATCCAGAATGGTAACCTCCATGAATCTGATTCTGAGAATGTACCCCGGGAATTTAAATTATCTGATGCATTGGCTGTAGAAGATGAGCAAGTTGTACCTGTTCCACTGAATGTGGTTGATACTTCAAGTAGTGTTAGAGAAAGAAAGAAGAAGGAAAAGAAACACAAGCCTGTACTAGAAGAGCAGGTCACCAAAGAAAGTGATGTATCAAAGATTCCAGGCAAAAAAGTAGAACCTGTCCCAGTTACTAAACAGCCTACCCCGCCGTCAGAAGCAGCTGCCTCAAAGAAGAAACCAGGGCAGAAGAAGTCTAAAAATGGAAACGATGATCAGGATAAAAAGGTGGAAACTCTTATGGCACCTTCAAGAAAGCAAGAATCATTACCCCTCCACCAAGAGACTAAACAAGAAAGTGGATCAGGAAAGAAGAAAGTTTCATCAAAGAAGCAAAAGACAGAAAATGTCTTGGTAGACGAACCCCTTATTCATGCAACTACTTACATTCCTTTGATGGATAATGCTGACTCAAATCCCGTGGTGGATAAGAGAGAGGTTATTGATCTAATTAAATCTGACCAAGTAGAAGCAATTCAGAAAACAGGGGCTAAAAAACTGAAGACTGAAACTGACAAAGAAAATGCTGAGGTGAAATTTAAAGATTTTCTTCTGTCCTTGAAGACTATGATGTTTTCTGAAGATGAGGCCCTTTGTGTTGTAGACCTGCTAAAAGAGAAGTCTGGTGTGATACAGGATGCTTTAAAGAAGTCAAGTAAAGGAGAATTGACTGCACTTTTACATCAGCTTCAAGAAAAAGACAAATTACTTGCTGCTCTGAAGGAAGACGGCACTGCTATGAAGGATCGGTGTAAGCAGCTAACCCAGGAAATGATGACAGAGAAAGAAAGAAGCAATGTGGTTATAGCAAGGATGAAAGATCGGATTGGTGCATTAGAAAAGGAACATAATGTATTTCAAAACAAAATTCATGTCAGTTATCAAGAGACTCAACAGATGCAGATGAAGTTCCAGCAAGTTCGTGAGCAGATGGAGGCAGAGATAGCTCACTTGAAGCAAGAAAATGGCATACTGAGAGATGCTGTCAGCAACACTACAAACCAACTAGAAAACAAGCAGTCTGCTGAACTAAATAAACTGCGCCAGGATTATGCCAGATTGGTGAATGAGCTGACTGAGAAAACAGGAAAGCTACAGCAAGAGGAAGTCCAAAAGAAGAATGCTGAGCAAGCAGTTACTCAGTTGAAGGTTCAACTACAAGAAGCTGAGAGAAGGTGGGAAGAAGTCCAGAGCTATATCAGGAAGAGGACAGCAGAGCATGAGGCAGCACAGCAAGATTTACAGAGTAAATTTGTGGCCAAAGAAAATGAAGTACAGAGTCTGCATAGTAAGCTTACAGATACCTTGGTATCAAAACAACAGTTGGAACAAAGACTAATGCAGTTAATGGAATCGGAGCAAAAAAGGGTGAACAAAGAAGAGTCTCTACAAATGCAACTTCAGGATATTTTGGAGCAGAATGAGGCTTTGAAAGCTCAAATTCAGCAATTCCATTCCCAGATTGCAGCTCAGACCTCTGCTTCAGTTCTAGCAGAAGAATTACATAAAGTGATTGCAGAAAAGGATAAGCAGATAAAACAGACTGAAGATTCTTTAGCAAATGAACATGATCATTTAACAAGTAAAGAGGAGGAACTTAAGGATATACAGAATATGAATTTCTTATTAAAAGCTGAAGTGCAAAAATTACAGGCCCTGGCAAATGAACAGGCTGCTGCTGTACATGAACTGGAGAAGATGCAAAAAAGTATTCATGTTAAGGATGATAAAATAAGATTGCTTGAAGAGCAGCTACAGTGTGAAATTTCAGACAAAATGGAAGAATTTAAGATTCTAAATGACCAAAACAAAGCATTACAATTAGAAGTTCAGAAGCTACAGACTCTTATTTCTGAACAGCCTAATAAAGATGTTGTGGAACAAATGGAAAAATGCATTCAAGAAAAAGATGAGAAGTTGAAGACTGTGGAAGAATTGCTTGAAACTGGGCTTATTCAGGTGGCCACTAAAGAAGAAGAACTGAATGCAATAAGAACAGAAAATTCATCTCTGACGAAAGAAGTTCAAGACTTAAAGGCTAAGCAGAATGATCAGGTTTCTTTTGCATCTCTAGTTGAAGAACTTAAGAAAGTGATCCATGAAAAAGATGGAAAGATCAAGTCTGTGGAAGAGCTTCTGGAAGCTGAACTTCTCAAAGTTGCTAATAAGGAGAAGACTATTCAGGATTTGAAACAGGAAATAGAGGCTCTAAAAGAAGAAATAGGAAATATCCAGCTTGAAAAGGCTCAACAGTTATCTATCACTTCTCAAGTTCAGGAGCTTCAGAACTTGTTAAAAGGAAAGGAGGAACAGATAAATACCATGAAGACTGCTTTAGAAGAGAAGGAGAAAGATCTAACTAATAGAGGGAAATGGTTACAGGATCTTCAAGAAGAAAATGAATCTTTAAAAGATCATGTTCAGGAGATAGCACAACATAACTTGAAAGAGGCATGTTCTGCATCACGATTTGAAGAACTTGAGACTGTGTTGAAAGAAAAGGAAAATGAAATGAAGAGAGTAGAAACTATGCTGAAGGAGAGGGAGAGTGATCTTTCTAGCAAAACAAAGCAGTTACAGGAGGTACAAGATGAAAACAGATTGTTTAAATCCCAAATCGAGCAGCTTAAGCAACAGAACTACCAACAGGCATCTTCTTTTTCCCCTCATGAAGAACTATTGAAAGTAATTTCAGAAAGAGAGAAGGAAATAACTTGTCTCCAGAATGAGTTAGATTCTTTGAAGGATGCGGTTGAACACCAGAGGAAGAAAAATAATGACCTTCGGGAGAAAAACTGGGAAGCAATGGAAGCATTGGCATCAACTGAAAAAATGCTGCAGGAGAGAGTGAACAAGACTTCCAAGGAAAGACAACAACATGTGGAAACTGTTGAGTTGGAGGCTAAGGAAGTTCTCAAAAAATTATTTCCAAAGGTGTCTGTCCCTTCTAATTTGAGTTACAGCGAATGGTTACGTGGATTTGAAAAGAAGGCAAAAGAATGTGTGACTGAAACTTCAGGTTCAGAGGAGGTTAAGGTTCTAGAGCACAAATTAAAAGAAGCTGATGAAATGCACACATTGTTACAGCTGGAGTGTGAAAAATATAAGTCCGTCCTTGCAGAAACAGAAGGAATTTTACAGAAGCTACAGAGAAGTGTGGAACAAGAAGAAAATAAATGGAAAGTTAAGGTCGATGAATCACAAAAGACTATTAAACAGATGCAGTTGTCATTCACATCTTCGGAACAAGAGCTAGAGCGATTAAGAAAAGAAAATAAAGATATTGAAAATTTGAGACGAGAACGAGAGCATTTGGAAATGGAACTAGAGAAGGCAGAAATTGAACGATCTACCTATGTCACAGAAGTCAGAGAGCTGAAAGATCTGTTGACTGAATTGCAGAAAAAACTTGATGATTCATATTCTGAAGCAGTAAGACAGAATGAAGAGCTAAATTTGTTAAAAACACAATTAAATGAAACACTCACAAAACTTCGAACTGAACAAAGTGAAAGACAGAAGGTAGCTGGTGACTTGCATAAGGCTCAACAGTCACTGGATCTTATCCAGTCAAAAATAGTAAAAGCTGCTGGAGATACTACTGTTATTGAAAATAGTGATGTTTCCTCAGAAATGGAATCTTCTGAGAAGGAGACAATGTCTGTAAGTCTAAATCAGACTGTAACACAGTTACAGCAGTTGCTTCAGGCAGTAAACCAACAACTCACAAAAGAGAAAGAACACTACCAGGTCTTAGAGTGAAGTAATTGGGGAAACCATTCAAGGATAACAGGAGGCATTGTATTATATTTTGCCAAATTAAAGCCTTATTTATGTTTTCACCCTTTCTACTTCGTCAGAAACACTGAACAGAGTTTTGTCTTTTCTAATCCTTGTTAGACTACTGATTTAAAGAGAGAGAAAAAAAGCCAACTCTGTAGACACCTTCAGAGTTTAGTTTTATAATAAAAACTGTTTGAATAATTAGACCTTTACATTCCTGAAGATAAAATAAACATGTACTCTTTTATCTTATTTTGCTCAATAAAATTGTTCAGAAGATCAAAAGTGGTAAAGACAATGTAAAATTTAACATTTTAATACTGATGTTCTACACTGTTTTACTTAACATTTTGGGGAGTAACTGCCTCTGACTTCAACTCAAGAAAACACTTTTTTGTTGCTAATGTAATCAGTTTTTGTAATGGCGTCAGCAAATAAAGGGATGCTTATTATTCA