Transcript asmbl_53805

Sequence
Transcript Sequence for observation asmbl_53805 of TGE0006369:
CAGCCAATGAGAGAGCCTATTACTAGTTTGCGTGCTGTGGTGTAGGGGGTGCGCTTAAGGCCCTGAAGCGCTACGCGTTCTGCTGGTTTTATCAGCATGAGCTCAATCGGTACCGGGTATGACCTGTCAGCTTCCACATTCTCTCCTGATGGAAGAGTTTTTCAAGTTGAGTATGCGATGAAAGCTGTGGAAAATAGTAGTACAGCTATTGGAATCAGATGTAAAGACGGTGTTGTCTTTGGGGTAGAAAAATTAGTCCTTTCTAAACTTTATGAAGAAGGTTCCAACAAACGACTTTTTAATGTTGATCGGCATGTTGGAATGGCAGTAGCAGGTTTGCTGGCAGATGCTCGTTCTTTAGCTGACATTGCAAGAGAAGAAGCTTCCAACTTCAGATCTAACTTTGGCTATAACATTCCACTAAAACATCTTGCAGACAGAGTGGCCATGTATGTACATGCATATACACTCTACAGTGCTGTTAGACCTTTTGGCTGCAGTTTCATGTTAGGATCTTACAGTGTGAATGACGGTGCACAACTCTACATGATTGACCCATCAGGTGTTTCATATGGTTATTGGGGCTGTGCTATCGGCAAAGCCAGGCAAGCTGCAAAGACAGAAATAGAAAAGCTTCAGATGAAAGAAATGACCTGCCGTGATGTTGTTAAAGAAGTTGCAAAAATAATTTACATAGTACACGATGAAGTTAAGGATAAAGCTTTTGAACTAGAGCTCAGCTGGGTTGGAGAAATAACTAAAGGAAGACATGAAATTGTTCCAAAAGATATAAGGGAAGAAGCTGAAAAATACGCTAAGGAATCTTTGAAGGAAGAAGATGAATCAGATGATGACAATATGTAACACTTCTGCAGCTGTTTTAAATTTCTATTATAGTTCCCATGTAACTATTTAGCCCTGTGGATTATTACATACCTACTGACCAATTTTCATTAAAATTTTGTCTTGTAATGA