Transcript asmbl_51708

Sequence
Transcript Sequence for observation asmbl_51708 of TGE0000988:
CAGGTGACCTCCGAAAATGGTTCGCTATTCACTTGACCCAGAAAACCCCACTAAATCATGCAAATCAAGAGGTTCAAATCTTCGTGTTCACTTTAAGAATACTCGTGAAACTGCCCAGGCCATCAAGGGTATGCATATTCGAAAAGCCACCAAGTATCTGAAGGATGTCACTTTACAGAAGCAATGTGTACCATTCCGTCGTTACAATGGTGGAGTTGGTAGGTGTGCCCAGGCCAAACAGTGGGGCTGGACACAGGGTCGATGGCCTAAAAAGAGTGCTGAATTCTTGCTGCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAGGTGAACAAAGCTCCCAAGATGCGGCGCAGAACTTACAGAGCTCATGGGCGGATTAACCCCTACATGAGCTCTCCTTGCCACATTGAGATGATCCTTACTGAAAAAGAACAGATTGTTCCTAAACCAGAAGAAGAGGTTGCACAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCCCGGGAGTAAATTTAGCATCAAATAAATGCTAGTAAAAGTAAAAGCAGAATGTCGATTGTCTTTATTAGTAAATATACTTCAGGTCTCCGTGCAAGATGGATCAAACGTGTTTTCTTCTGATTAGAAATAGAAACATTCTGCTTGCCTTGTGTCATTAATTTTGGTTTGTAAACTTGTAATTTTGAATGTCTTCGTTTTTTTAGCCTATTATGGAGTTAGAACATAGG