Transcript asmbl_50572

Sequence
Transcript Sequence for observation asmbl_50572 of TGE0019597:
TGAGCATTCAGGTTTGCTAGTCAGGTTCCTGGGTATGACCGCTGCCTGGCCTGACACCTCCCAGGTTGGTCTCGGCCCAGTTTCCCATTGATCACTTCACACACATCTTCATCGATGAGGCTGGTCACTGCATGGAGCCCGAGAGTCTGGTGGCCATAGCAGGGCTGTTGGAAGTCAAGGAAACGGACAATCCAGGAGGACAGCTGGTGCTAGCCGGAGACCCTCGGCAGCTGGGGCCCGTTCTGCGTTCCCCACTGGCCCAGAAGCATGGGCTGGGGTACTCGATGCTGGAGCGGCTGCTCACCTACAACACCTTGTACAAGAAGGGCCCCAATGGCTATAACCCCCAGTACATAACCAAGCTTCTGCGCAACTACAGGTCTCACCCCAACATCCTGGACATTCCTAACCGGCTCTATTACGAAGGGGAGCTGCAGGCCTGTGCCGATGTCCTTGACCGAGAGCGCTTCTGCCACTGGGAGGATCTGCCTCGAAAGGGCTTTCCCATCATCTTTCATGGCGTAATGGGCAAGGACGAGCGTGAGGGCAATAGCCCATCCTTCTTCAACCCCGAAGAGGCTGCCACGGTGACTTCCTACCTGAAGCTGCTCCTGACTTCCTCCTCTAAGAAGGGCAGAGCCCGCCTGAGCCCCCGAAACGTGGGCGTCATCTCCCCTTACCGGAAGCAGGTGGAAAAAATTCGATATTGCATCACCAAACTTGACAAGGAGCTTCGGGGACTGAATGACATCAAGGACTTGAAGGTGGGCTCCGTGGAGGAGTTCCAAGGCCAGGAACGCAGCGTCATCCTCATCTCCACCGTGCGCAGCAGTCAGAGCTTTGTACAGCTGGATCTGGACTTTAACCTGGGTTTCCTGAAGAACCCCAAGAGGTTCAACGTGGCTGTGACTCGGGCCAAGGCTTTGCTCATCGTGGTGGGCAACCCGCTCCTCCTGGGCCATGACCCCGACTGGAAGACATTCCTGGATTTCTGTAAAGAAAATGGGGGGTATACTGGGTGCCCCTTCCCTGCCAAACTGGACCTGCAGCAAGGACAGAACTTACTCCAAGGTCTGAGTAAGCTCAGCTCCTCTACCTCAGGGCCCCGAAGTCGCGACTACCTCCCCCAGGAGCGAGGGCGCGAAGGCGGCCTGCACCTGCAAGTGGAGCCAGAGTGGAGGAACGAGCTCTGAAGAGATGGCGGCTGGCCTCGCGCGCCAGTCAAGCCTTCCGTGCCCGGCCACCCGGCCACCCGCCCTGACCCAGAACCCAGCCGAGCTGCCCCTCCCAGGGACAGGAAGGCTGGGAGTTTACATCCCCTCCCCTGCTGGAAAGAAAGAAAAACAATGA