Transcript asmbl_50271

Sequence
Transcript Sequence for observation asmbl_50271 of TGE0006193:
GCCTGCGCACGAGCTGGGGCCTTTTTTCCCCCCGGAGCTGTGCTTGGCCTGTAGGTCTGTGACGAGCCGCGAACGCGGGTCTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGTTGTCAAGAATAAGGCCTACTTCAAGAGATACCAAGTGAAATTCAGAAGACGACGAGAGGGTAAAACTGATTACTATGCCCGAAAACGTTTGGTAATCCAGGATAAAAATAAGTACAACACACCCAAATACAGGATGATAGTTCGTGTAACCAACAGAGATATCATTTGTCAGATTGCTTATGCCCGTATAGAAGGAGATATGATAGTTTGTGCAGCTTATGCTCATGAACTTCCAAAGTACGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATATTGTACTGGCCTGCTGCTGGCCCGCAGGCTTCTCAATAGATTTGGCATGGACAAAATCTATGAAGGCCAAGTGGAGGTGACCGGAGATGAATACAATGTGGAAAGCATTGATGGTCAACCTGGTGCCTTTACCTGCTATTTGGATGCAGGGCTTGCAAGAACTACTACTGGAAATAAAGTTTTTGGGGCCCTGAAGGGAGCTGTGGATGGAGGCTTGTCTATTCCTCACAGTACCAAACGATTCCCTGGCTATGATTCAGAAAGCAAGGAATTCAATGCAGAAGTACATCGGAAGCACATCATGGGTCAGAACGTTGCAGATTACATGCGTTACCTAATGGAAGAAGATGAAGACGCTTATAAGAAACAGTTCTCTCAATACATAAAGAACAACGTAACTCCAGACATGATGGAGGAGATGTATAAGAAAGCTCATGCTGCTATACGAGAGAATCCAGTCTATGAGAAGAAGCCTAAGAAGGAAGTTAAAAAGAAGAGGTGGAACCGTCCCAAAATGTCTCTTGCCCAGAAGAAAGATCGGGTAGCTCAGAAGAAGGCAAGCTTCCTCAGAGCTCAGGAACGGGCTGCTGAGAGCTAATAAACCAAACTGAAATTTTCTATTAAGATTTTTCATATAAAGATAGTAATAAACTTATTGAATCTGCA