Transcript asmbl_14110

Sequence
Transcript Sequence for observation asmbl_14110 of TGE0000255:
CTGCCGGAGTACCGGGTACGGTCCGCGAAAAGTGACCCTGGGACTGCGTGCATGCATGCCTCCGGGGTGGATGGCATTCCGCCAACAGGGTCACTCCGATAGCGCCCGGCAGCCCAAGCACCCTTCCTACCCTTCCTGCCTCCCTGAAGTCCAGCATTAATCCCCTACCCGGCGACACCCGGCAGCCCCTTCACCCCTGTGTACCTCGCAGGATGCAGAGATTGTGCGGACCCGGGATCCCGAAAAACTCGCTTCCTGTGACATCGTGGTGGACGTGGGGGGCGAGTACGACCCTCGGAGACACCGATATGACCATCACCAGAGGTCTTTCACAGAGACCATGAGCTCCCTGTCCCCTGGGAAGCCGTGGCAGACCAAGCTGAGCAGTGCGGGACTCATCTATCTGCACTTCGGGCACAAGCTGCTGGCCCAGTTGCTGGGCACTAGTGAAGAGGACAGCATGGTGGGCACCCTCTATGACAAGATGTATGAGAACTTTGTGGAGGAGGTGGATGCTGTGGACAATGGGATCTCCCAGTGGGCAGAGGGGGAGCCTCGATATGCACTGACCACTACCCTGAGTGCACGAGTTGCTCGACTTAATCCTACCTGGAACCACCCCGACCAAGACACTGAGGCAGGGTTCAAGCGTGCAATGGATCTGGTTCAAGAGGAGTTTCTGCAGAGATTAGATTTCTACCAACACAGCTGGCTGCCAGCCCGGGCCTTGGTGGAAGAGGCCCTTGCCCAGCGATTCCAGGTGGACCCAAGTGGAGAGATTGTGGAACTGGCGAAAGGTGCATGTCCCTGGAAGGAGCATCTCTACCACCTGGAATCTGGGCTGTCCCCTCCAGTGGCCATCTTCTTTGTTATCTACACTGACCAGGCTGGACAGTGGCGAATACAGTGTGTGCCCAAGGAGCCCCACTCATTCCAAAGCCGGCTGCCCCTGCCAGAGCCATGGCGGGGTCTTCGGGACGAGGCCCTGGACCAGGTCAGTGGGATCCCTGGCTGCATCTTCGTCCATGCAAGCGGCTTCACTGGCGGTCACCACACCCGAGAGGGTGCCTTGAGCATGGCCCGTGCCACCTTGGCCCAGCGCTCATACCTCCCACAAATCTCCTAGTCTAATAAAACCTTCCATCTCATACTGACCCAGTCCTTGACTTATTCTTGCCCTACACCATTCCA