Transcript asmbl_50114

Sequence
Transcript Sequence for observation asmbl_50114 of TGE0006178:
GGGAAGATGGCGGCGTCCAGGTGGCGGTCTTGAGGAGACCGAACCGGTATGGCTTTGGCGTCGGGCCCCGCAAGGCGGGCGCTTCGTCTACCTGGAAGGCTCGGCTTTGGGGGCGACGGGACCCCGAGACGCGGGGCGTACGAGTGGGGCGTTCGCTCCACGCGGAAGCCCGAGCCTCCTCCCCTGGACAGGGTGTATGAAATCCCTGGACTGGAGCCCATCACCTACGCGGGGAAGATGCACTTCGTGCCCGGTCTGGCGCGGCCGGTCTTTCCGCCGTGGGATCCTGGCTGGACGCACCCAAAGTTCCGCCGCGCGCCCCCGATCCAAGAGCATCCGCTGTACAAGGACCAGGCCTGCTACACCTTCCACCAGCGTTGCCGCCTCCTCGAGGGTGTAAAGCAGGCTCTCTGGCTTACCAAGGCCAAGTTAATAGAAGGCCTTCCTGAGAAAGTGCTTAGCCTTATTGAGGATCCAAGGAACCACATAGAGAACCAAGATGAACGCGTTCTGAATGTGATCTATCACGCCCGTCTCTGGCACTCCACTGAAAACATCCCCAAGAGAACGACCTACTGCCCAATCATTGTGGACAGTCTGTTACAGCTGTGTAAATCCCAGACTTTCAAGCATCCTTCACTAGCCAGGCGGATCTGTGCCAAAAACTACACGTTATCCACCACTTGGAATCGAGAGTCTCTTCTCCTTCAGGTCCGTGGTTCTAGTGGAGCCCGACTGAATGCCAAGGACCTTCTGCCCCCCATTGCCTCCAGAGAGGAGGTAGAAGCTACTAAGAATCATGTTCTTGAAACCTTCTATCCCATATCTCCCACTGTCGATCTTCAGGAATGCAATGTTTATGATGTGAAAGACGACACAGGATACCGGGAGGGTTATCCTTATCCCTATCCCCACACCCTGTATTTTCTGGAGACAGCCAATTCACGACCATACCGCTTTCAACCAGATCAGCTGCGGGCCAAGATGATCCTGTTTGCCTTTGGCAATGCCTTGGCTCAGGCCCGGCTCCTCTATGGGAATGACACTAAGGTTTTGGAGCAGCCAGTAGTTGTGCAGAGTGTGGGCACCGATGGACGTGTCTTCCAGTTCTTGGTGTTACAACTGAACACCACAGATCTGGCCTCTAATGAGGGCATCAAGAATCTGGTGTGGGTGGACTCAGACCAGCTCCTCTATCAGCATTTTTGGTGTCTCCCAGTGATCAAAAAGAAGGTGGTTGTGGAACCTGTTGGGCCGACTGGTTTTCAGCCAGAGACGTTCAAGAAGTTTTTAGCTTTGTATTTGCACGGTGCTGTATGAGCCAAGGACTGTTCTGCAGCCTCACGTACCCCCTCGCTTCAACCCACCGAAGACCCTGCAGCCTGGGCAGGGCCTGGGGTCTGCCCGGAGCCTCAGTGCTCTTTTGGCCTGGTGGGCTCGCTGACAATAACGAGTGCTTCCAGTGCACTGGAGTCTGTGCTTGGTGTGAGGGTGCTGTTGGGAGGGACATCCAGTTTCATGTGGGCCCACACCTTGAGCCTGCCGCCATATAAATGCAGGCCCTGGAGTCTGACCTGCCGCATCTCTGCCCACCACCCATTTTGTGACTTTAGATAAAAGTCTTCATCTAAGTTTCAATTTCTTCATCTGAAACTTGGGCCTAACATAACCTACCTTATTTTGAAGACTATAGCTTATGTATGTGTATTGTCTGTCACATAGTAGGTGCTCTGTGATGGTTGCTCAGTTCTTTTGGGGTTATTTAAATTGTGGACACATTCACAATGACTGCAGAAATTCTGAATAGAATATTCATTGTAGATTTCTCAGCTAGTGTCCTGGTTACTGGACCAGTACACCCCTGGTTCAGCTGGCCTCCTATTTGTTCTAACAACATCCGGTCCTGCTCTGGGCCAGGTACCTATACACAGCATCTTACTTAATCCTTACACAACTCTTGACAAGGTAAATGTCATTTCCATATGCAATAAATATGTTGAATACCTA