Transcript asmbl_48075

Sequence
Transcript Sequence for observation asmbl_48075 of TGE0006087:
GTGGTGCGGCTGCGAATAGAAAGGGTGACAGGTGACATAGTTGGAGTTGAATCTGTGGAGCGCTCAGGCGTTTGGTGCGGACACCTCGCGGAGTCCTTTCTCACTGCCGTCTTGTGCGGGAGGCTTGTCCCTCCCTACCTGCTGCTCCAGGCTGAGGCTTCCCTAGTGCATCTGTCCGCCGATTCATGATTTTCTGCCGTTTCTTGGCAAAAATGGCAAACAATGATGCTGTTCTGAAAAGACTGGAACAGAAAGGTGCAGAGGCAGATCAAATTATTGAATATCTTAAGCAGCAAGTTGCTCTTCTTAAGGAAAAAGCAGTTTTGCAGGCAACTTTGAGAGAAGAGAAGAAACTTCGAGTTGAAAATGCTAAGTTGAAGAAAGAAATTGAAGAATTGAAGCAAGAACTAATTCAGGCAGAAATTAAAAATGGAGTGAAACAAATACCATGTCCACCTAGTACTCTACTGCAAGCTAATTCCACGGTTTCTGAAAATGTGATGCAGTCCGTACTATTAACAACCATGTCTTCTGGTACCAAAGAACAGATAAAAGGAGGAGGAGAAGAAGCAAAGAAGGTGAAAGAGAAAATTGAAAAGAAAGGAGAGAAAAAGGAGAAGAAACCTCAATCAGTAGCAGGAGGTGCTGACTCTAAGCCAATAGATGTTTCCCGTCTGGATCTTCGCATTGGTTGTATCATCACTGCCAAAAAACATCCTGATGCAGATTCTTTGTATGTAGAAGAAATAGATGTTGGAGAAGCAGCCCCAAGAACAGTTGTCAGTGGCCTGGTAAACCATGTTCCTCTTGAACAGATGCAAAATCGGATGGTGATTTTACTTTGTAACCTAAAACCTGCAAAGATGAGGGGAGTACTATCTCAAGCAATGCTGATGTGTGCTAGTTCACCAGAGAAAGTTGAAATCTTGGCACCTCCTAATGGGTCTGTTCCTGGAGACAGAATTACTTTTGATGCTTTTCCTGGAGAGCCTGATAAAGAGCTGAATCCTAAGAAGAAGATTTGGGAGCAGATCCAGCCTGATCTTTACACTAATGATGAGTGTGTGGCTACATACAAAGGAGCTCCCTTTGAGGTGAAAGGGAAGGGAGTGTGTAGGGCTCAAACTATGACGAACAGTGGAATAAAATAAAATTAGAATGCTTCAGTTACTGAAATACATTGGAAAAAACTTTAATAACAATAAAAAGAAATACATTTGTCACTTATACCTAAAATATAACTGGCTCTTTGTGCGCTTTCTCTTCTAGACTTAACTAGTCTTTTACCTGGTGTATATTATTTTCAGTTGATTAGAAAAACACTACGTTTTTACCTATGATTTTTGATCCTTTAAAATGTAGGGAGGAAATGGCCTATGTTTTGTGATGATTTATTTTTTAGCAAGGATGTTGGTTAGCAGTTTGTTTTTCCTTTATACAGTTTTAGATGAACTTGATTCATATTTAGTTTCTTATTTGTAGGCACATGACACATGAAATTTCAGCCCTTGGGTTTTTAGTATATTGTGTATCTGTGTTATAAATCTCTCTCCCTTTTCAAAAATGATGAGTTGGAATTTTTGTAAGGTTTATCAACTAGTCACATTGTAATAATATTAAAAATGAACAATTTGATTCTTGAGAGCCAAGCATCATAAAATCTAGGAGATGTGGCATTTGAACATTATTGTTATTGCTTGCCAAAATAACCCAGACTTGTATTTTTCAGG