Transcript asmbl_47820

Sequence
Transcript Sequence for observation asmbl_47820 of TGE0006056:
GTGAAAGAGTTCTTAGCCAAAGCCAAAGAAGATTTTCTTAAAAAATGGGAAAATCCTGCTCAGAATACAGCCCATTTGGATCAGTTTGAACGAATCAAGACCCTCGGCACAGGCTCCTTCGGGCGGGTGATGCTAGTAAAACACAAGGAGACCGGGAGCCACTTCGCCATGAAGATCCTGGACAAACAGAAGGTGGTAAAGCTGAAACAGATCGAGCACACCCTGAACGAGAAGCGCATCCTGCAGGCAGTCAACTTTCCGTTCCTCGTTAGACTCGAGTTCTCCTTCAAGGACAACTCAAATTTATACATGATCATGGAGTATGTGCCTGGCGGGGAAATGTTCTCACACCTGCGGCGGATCGGAAGGTTCAGCGAGCCCCATGCCCGCTTCTACGCCGCCCAGATCGTCCTGACCTTCGAGTACCTGCACTCCCTTGATCTCATCTACCGGGACCTGAAGCCGGAGAACCTTCTCATCGACCAGCAGGGCTACATTCAGGTTACAGACTTTGGTTTTGCCAAGCGTGTGAAAGGCCGCACCTGGACCTTGTGTGGGACCCCTGAGTACCTGGCCCCTGAGATCATACTGAGCAAAGGCTACAACAAGGCTGTGGACTGGTGGGCACTGGGGGTTCTCATCTATGAGATGGCCGCCGGCTACCCACCCTTCTTCGCTGACCAGCCCATCCAGATCTATGAGAAGATTGTCTCTGGGAAGGTGCGGTTCCCGTCTCACTTCAGCTCTGACCTGAAGGATCTGCTGCGGAACCTACTGCAGGTGGACCTCACCAAGCGCTTTGGGAACCTCAAGAATGGGGTCAATGACATCAAGAACCACAAGTGGTTTGCCACAACTGACTGGATCGCCATCTACCAGAGGAAGGTGGAAGCTCCCTTCATACCAAAGTTTAAAGGCCCTGGGGACACGAGTAACTTTGACGACTATGAGGAGGAAGAGATTCGAGTCTCCATCAATGAGAAGTGTGGCAAGGAGTTTTCTGAGTTTTAGGGGTGTGCCTGTGCCCCCAAGGGTTTTTTCTTTTTTTGTGTGGGGGGGGTGGGTGGGAGGGTTGGATTGAACAGCCAGAGGGCCCCAGAGTTCCTTGCATCTAATTTCACACCCACCCCACCCTCCAGGGTAGGGGGAGCAGTAAGACCAGATATTCAGAGGGACAGAAACACCAGCTGCTCCCCCTCACCCCTTTCGCCCTCCTGCCTCCCTACTGCTTTTGCCTTCCCCTATCCTTATGGCCCCCCACCCCAGCCCACTTCTGCCTATTTTAAATAAGTTCTCAGTTCTAGTCAGGCCAGGTCTTGCTAGTGTATCCAGGGACAGGGTGTGGAAAGAGGGGCCGGAACTTAACTCCAGCCCCCACTTCCACCTCCCTCACCAAACCACAGGCACCACCTGCTAAGGGAGAATGAAAGAATGGCCAACCTTCCCTTCAGAGCAATCCTACCCGGGAAGGAGAGATTTTAGTGACATACCAGTGGGTTGCTTGCTAGAGTTTTTTAAAAAGCAATTTACAATCTTATTTACAAACTTATTTAAGTTCCACCAGTGCCTCCCTCCCACCTTCCTAAAGCCCCCTCCCATGCCCCCTCCTCAAATCCATTTTAACAAGGCTGGGAAGCAGACTGACTTATAAAGGAAGGAACTGGGGTTCCAACCTCCCCTCCAAGCTGCTAATCTCCCCTGTCCCCCACTCCTGGGGTCCCCTGCCAAGCCTGGAAGGGTCTTAGCCCCTGAAGCCTATTCCCTTCTGCCCCAACAGACCTTTTGTCACCCTTGGGCTTTGGGACCCAGACAAAGCAGCTGCCCCCCTCCCTGCCAAAGAGGAGTTGTCCCCCAAAATGATAGAGTGGGAGCCCCAAGCCCAGGGTCTTTCCTCCCAGCAGCACTCCCCCCAAAACTCCTTAATTTTATTCTCAGCTAGATTTTAATGCCCAGCCTCCTCTCAGCTCAGTTGGGAAGGCATCCCCCGCAAAAGGAGGCAAAGCCCCCCTCCCCCTCCTGGCCCCGGTTCAAGGCCAGGGTCGCTGGGGAAGGGCTGCCAGTTTTATTCACTGAACTATCTCCGCCCCCCATCCTGGGCGCTCCTCCTATTAGCTGTCAGCTGTCCATCACCCCTCCCCTAATTTGTGCTTCTTTTTCTCTGAATAGAAGTGGGGAGCCCAAATCTGTCCCTCTCATAACTTCTCCCTATCCCAGGAGGAGCTCTCAGGCCTGGGGTGGGGCCCCGGGTGGGCACGGGGGCGATTCAACCTGTGTGCTGCGAAGGACGCGACTTCCTCTCGAACAGTGTGCTGTTGTAAACATATTTGAAAACTATTACCAATAAAGTTTTGTTTAAAAAAAA