Transcript asmbl_46456

Sequence
Transcript Sequence for observation asmbl_46456 of TGE0005955:
CGCGCAGGCGCCTTGGGGACCCGGTAGCGGCGGTGGCAGTGGCTGCGGCGACGGGATCCTTGGCCGAAACTGAAGGCGGTGGTGGCGGCCATGGCGGCCGATGGAGAGCGATCCCCGCTGCTCTCCGAGCCCATCGATGGTGGTGCTGGCGGCAATGGATTAGTGGGACCAGGCGGGAGTGGGGCTGGGCCCGGGGGAGGCCTGACCCCCTCCGCACCACCGTACGGAGCCGGTAAACATACCCCGCCCCAGGCATTTCCCCCATTCCCTGAGGGACATCCAGCCGTGTTGCCTGGGGAGGACCCACCCCCCTACTCACCCTTGACTAGCCCGGACAGTGGGAATGCTCCCATGATCACCTGCCGAGTCTGCCAGTCTCTCATCAACGTGGAAGGCAAGATGCATCAGCATGTAGTCAAATGTGGCGTCTGCAATGAAGCCACTCCAATCAAGAATGCACCCCCAGGGAAAAAATATGTTCGATGCCCTTGTAACTGTCTCCTTATCTGCAAAGTAACTTCCCAGCGGATTGCCTGCCCTCGACCCTACTGCAAAAGAATCATCAACCTGGGGCCTGTGCACCCAGGACCTCTGAGTCCAGAACAACAACCTGTAGGTGTCAGGGTCATCTGTGGACATTGCAAGAATACTTTTCTGTGGACGGAGTTCACAGACCGAACCTTGGCCCGTTGCCCTCACTGCAGGAAAGTGTCATCTATTGGGCGCAGATATCCACGAAAGAGGTGTATCTGCTGCTTCTTGCTTGGCTTACTCTTGGCAGTCACTGCCACTGGCCTTGCCTTTGGGACATGGAAGCATGCACAGCAATATGGAGGCATCTATGCAGCCTGGGCATTTGTGATCCTGTTGGCTGTGCTGTGTTTGGGGCGGGCCTTCTATTGGGCCTGTATGAAGGTCAGCCACCCTGTCCAGAACTTCTCCTGAGCCCCATGATCACCCACAGACTGTGCCTGGCCCCTTCCTGGTGGGGACAGTGACACTACAAAGGGAACCATAATCAAAGGCTCCCTGGGCTTCTATAAGGGAAGCCAAGCAGCTGCCTTCCTTTTCCCTGGCGAGAGGTAGGAAGGGACCAGGCCCTCACCTAGGTTTGGAGGGGTAGAAAAGGCCACTGTTGGCCTGGCCACCTGCTTTCCTCCAAGAGTTGCTATGTTTAGGGTGAGGTAGGTGAAATGTTGCCCCTAAACCTGGGTCATAAAAGATGGTTCTAGCCATGTCCTTCCTATGTGCTCCCTGAGAGCCATTCCTGTCCCTTACACATTCCAGGGCAGGGTGGGGGTGGGTAGCCCTGGGGGTTTCCCTCCCTCTTGTGTACCATTAGGACCTTGCTGCTGCTATTGCACTTCACCAGGGGCTGGCTCTGGCCTCAGTACCCTCAGTCTCCTCCCCCCATTCCATGTCCTATGGGGGTGGGGTCAGCCGCTGCTCTGTACAGAACCACAGGAACTGATATGTATATAACTATTTAATATGGGGAATGTCCCCCTAGTCCTGTGTTTCCCTTAATTCCTCCTTCCAACCTTACTCCCCAGTGTATTTAACTGGGCTGGGTAGGGTTGCTCTGTTGTGGGGGAGGTTAGGGATTCATCCTGTGCTTGTAAATAAATAAGGTCGTGACT