Transcript asmbl_46420

Sequence
Transcript Sequence for observation asmbl_46420 of TGE0005949:
TGCACTATCTGTGCAGACAGGACGGGAGACCGCGGTGTCGTTTAGCAGAGCAGAACCGAGTTGAGAAGGTCAGGCTCATCTAGAGGGTGTCGGCGGAAACATGGAGAAACGACTCACATATGAAGATTGTCAGTACACTGCAGAATGGCTTCTGTCCCACACCAAGCACCGACCTCAAGTGGCAGTGATCTGCGGTTCTGGGTTAGGAGGTTTGACTAATAAATTAACTCAGACCCAGATCTTTGACTACAGTGAGATACCAAACTTCCCCCAAAGTACAGTGCAAGGTCATGCTGGTCGACTGGTGTTTGGGTTCCTGAATGACAGAGCCTGTGTGATGATGCAGGGCAGGTTCCACCTGTATGAAGGCTACCCGCTCTGGAAGGTGACATTCCCAGTGAGGGTTTTCCAGCTTCTGGGTGTGCACACCCTCGTGGTCACCAATGCAGCTGGAGGGCTCAACCCCAAGTTTGAGGTTGGAGACATCATGCTAATCCGCGATCACATCAACCTACCTGGTATTTGCGGTGAGAACCCTCTCATAGGGCCCAATGATGAAAGGTATGGAGTTCGTTTTCCTGCCATGTCCGATGCCTATGACCGGGAGATGAGGCAGAAGGCTCATAGTACCTGGAAACAAATGGGAGAGCAGAGAGAGCTACAGGAAGGCACCTACGTTATGGTGACGGGCCCCAGCTATGAGACTGTGGCAGAGTCTCGTCTGCTGCAGCAACTGGGTGCAGATGCTGTTGGCATGAGCACAGTACCAGAAGTTATAGTTGCAAGGCACTGTGGACTTCGAGTCTTTGGCTTCTCCCTCATCACGAACAAGGTCATCATGGATTATGAAAGCCTTGAGAAAACAAACCATGAGGAAGTACTAAAGACCGGGAAACAAGCTGCGCAGAAATTGGAGCAGTTTGTCTCCATTCTTATGACTAGCATTCCACTGCCTGACCATGCTAGTTAACCAGCCCTGGGGTGGTCTGGCTTCTCCCTTATGGTTTCCAAGTAGTTGCTACCTACTTTGCTGGGGTCACATGCCTCTGTCCTTACGCAGTAGCAGAAAAGAGAGGAAGATTTTTATATTTCCCTTTCCCACTTCTCCCACCAGATTCTTCTGGTGCTGGGTCCTCTTTTGCTCAATTGTCTTCTCAAAACAGTGTCCACCTCTATTCTTTCACAAGAGCTGGAGCTCAAGCCAAGCCCTACTACACATCCATAGATATTTGATGTTGGCTGTTGAACTTGACACAGTAGAAGTCGATGCTAGCTTTTTGAGATGATGTTCTCACATTCCTGGGGACTCAGTTCTGCCTCCCCCAAAGTACTGGAAACCACACAAGGACCAGCCCAATACCTTTTATACTTTTAATGCTTTATATTTTG