Transcript asmbl_46044

Sequence
Transcript Sequence for observation asmbl_46044 of TGE0005878:
CACACACTGGCCCCGGTGCCCACCCGCACCCCACCCCCAGAGCGCTGACTCGGCTCCCCGGACCTCGGCAGGATGGAAGAGAAGCTGAAGAAAACCAAGATCATCTTTGTGGTGGGCGGGCCCGGCTCGGGGAAGGGCACCCAGTGTGAGAAGATTGTCCAGAAGTACGGCTATACTCACCTTTCCACCGGGGACCTCCTGCGGGCCGAGGTCAGCTCGGGCTCGGCCAGGGGCAAGATGCTGTCGGAAATCATGGAGAAGGGGCAGCTGGTGCCGCTGGAGACAGTGTTGGACATGCTCCGAGATGCCATGGTAGCCAAGGTAGACATTTCCAAAGGCTTCCTGATCGATGGCTACCCTCGGGAGGTGCAACAGGGGGAAGAGTTTGAGCAGAGGATCGGACAGCCCACGCTGCTGCTGTATGTGGACGCAGGCCCCGAGACCATGACCAAGCGGCTCCTGAAGCGGGGAGAGACCAGCGGGCGTGTGGACGACAACGAGGAGACCATCAAGAAGCGGCTGGACACCTACTACAAGGCCACAGAACCTGTCATTGCCTTCTATGAGAAACGTGGCATCGTGCGTAAGGTCAATGCCGAAGGCTCCGTGGACAGTGTCTTCTCCCAGGTCTGCACCCACCTAGACGCCCTCAAGTAGCAGCGCCGGAGCCCCTTCCCCAGCTCAGAGCCCCACCCCACCCCTGTCCTGACTCAAGAACCCTGGCCTGAGCTCAGCGCCTCCGCCCTGCCCGCTGGAGCACAGACAGAGGAAGCCACTTTATCCTGTTTTCATGGACAGCTGAGCACTAAAGGAATTTCCGAGGACATTCGGTTTTACTCCTTTTTCTTTGCTTCCATCGGGGTTGATTCATGTGGGGTGGCCGCCCTGGCCTCGAGCCCCTCACCCTCCCCATTCCTCCTCAGGTCCCTCAGCCCACCTTGGCCGGCCGCCCCTCCCCAGTAGAAGGTCCCCTTCCTCACACAGGGTGTGCCGAGCTCAGACTGGGCCAGGCCTGGGGAGCCAGGGTCCTTGCTTTCTGGGACTCGTGGTCAGACAGAGCTGGGCCCTGGCCTGGATTCCTCTGCATTCTTGCTGTGTGGACTTGGCCCTGACCCCTCCTGTCTCTGAGCCCGTTTTCTGTGCCTAACCTCCTCTGGGGACTGAGCCATAGCAGGCAACAAGGTCATGGGCAGCGTGGGGCTCCCTGGTGGTGGGGGCAGCACACGTCGGCAAGCCAGGTGGGCAGGAAATTGGCCACCTTGGTACAAGAAGCCCCGAGGGTCTGAAAAGGACATCAAGAGTGAATGGGGGGAAGGGGTCAAGGTCAGGAGAGCCTCCCCGAGGA